[ { "assertion_id": 1, "context": "Chronic, accelerated, or blast phase", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for bosutinib for adult patients with chronic, accelerated, or blast phase Philidelphia chromosome-positive (Ph+) CML with resistance or intolernace to prior therapy.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BCR", "gene2": "ABL1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 1, "feature_type": "rearrangement" } ], "last_updated": "2021-09-16", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer Inc. Bosulif (bosutinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/203341s020lbl.pdf. Revised May 2021. Accessed September 16, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 1, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/203341s020lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bosutinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "targets BCR-ABL", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 2, "context": "Chronic phase", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for dasatinib for newly diagnosed patients with Philidelphia chromosome-positive (Ph+) CML in chronic phase. It is also approved for adults with chronic, accelerated, myeloid, or lymphoid blast phase Ph+ CML with resistance or intolerance to prior therapy, including imatinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BCR", "gene2": "ABL1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 2, "feature_type": "rearrangement" } ], "last_updated": "2020-11-12", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Bristol-Myers Squibb Company. Sprycel (dasatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/021986s021lbl.pdf. Revised December 2018. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 2, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/021986s021lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "targets BCR-ABL", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 3, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for dasatinib for adults with Philidelphia chromosome-positive acute lymphphoblastic leukemia (Ph+ ALL) with resistance or intolerance to prior therapy.", "disease": "Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BCR", "gene2": "ABL1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 3, "feature_type": "rearrangement" } ], "last_updated": "2020-11-12", "oncotree_code": "ALL", "oncotree_term": "Acute Lymphoid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Bristol-Myers Squibb Company. Sprycel (dasatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/021986s021lbl.pdf. Revised December 2018. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 2, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/021986s021lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "targets BCR-ABL", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 4, "context": "Chronic phase", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for imatinib for newly diagnosed adult and pediatric patients with Philidelphia chromosome-positive (Ph+) CML in chronic phase.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BCR", "gene2": "ABL1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 4, "feature_type": "rearrangement" } ], "last_updated": "2020-11-12", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Gleevec (imatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021588s056s057lbl.pdf. Revised August 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 3, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021588s056s057lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 5, "context": "Relapsed or refactory", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for imatinib for adult patients with relapsed or refactory Philidelphia chromosome-positive acute lymphphoblastic leukemia (Ph+ ALL).", "disease": "Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BCR", "gene2": "ABL1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 5, "feature_type": "rearrangement" } ], "last_updated": "2020-11-12", "oncotree_code": "ALL", "oncotree_term": "Acute Lymphoid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Gleevec (imatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021588s056s057lbl.pdf. Revised August 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 3, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021588s056s057lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 6, "context": "Chronic phase", "created_on": "05/07/26", "deprecated": false, "description": "Dasatinib (Sprycel) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for adult patients with newly diagnosed Philadelphia chromosome-positive (Ph+) chronic myeloid leukemia (CML) in chronic phase or in the setting of resistance or intolerance to prior therapy, including imatinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BCR", "gene2": "ABL1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 6, "feature_type": "rearrangement" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016]. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 4, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "targets BCR-ABL", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 7, "context": "Newly diagnosed chronic phase", "created_on": "05/07/26", "deprecated": false, "description": "Nilotinib was superior to imatinib in patients (n=846) with newly diagnosed chronic-phase Ph+ CML.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BCR", "gene2": "ABL1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 7, "feature_type": "rearrangement" } ], "last_updated": "2019-08-14", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Saglio G, Kim D, Issaragrisil S, et al. Nilotinib versus Imatinib for Newly Diagnosed Chronic Myeloid Leukemia N Engl J Med. 2010; 362(24):2251-2259.", "doi": "10.1056/NEJMoa0912614", "nct": "NCT00471497", "pmid": 20525993, "source_id": 5, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa0912614" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nilotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 8, "context": "Chronic phase", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administraton (FDA) granted approval to asciminib for the treatment of adult patients with Philadelphia chromosome-positive chronic myeloid leukemia (Ph+ CML) in chronic phase (CP) that have been previously treated.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BCR", "gene2": "ABL1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 8, "feature_type": "rearrangement" } ], "last_updated": "2024-11-06", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Scemblix (asciminib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/215358Orig1s008lbl.pdf. Revised October 2024. Accessed November 6, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 6, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/215358Orig1s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Asciminib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 9, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted regular approval to alectinib for treatment of patients with anaplastic lymphoma kinase (ALK)-positive metastatic non-small cell lung cancer (NSCLC), as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ALK", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 9, "feature_type": "rearrangement" } ], "last_updated": "2020-11-12", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Alecensa (alectinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/208434s004lbl.pdf. Revised June 2018. Accessed November 12, 2020.", "doi": "", "nct": "NCT02075840", "pmid": "", "source_id": 7, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/208434s004lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Alectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ALK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 10, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for crizotinib for the treatment of patients with ALK positive metastatic non-small cell lung cancer (NSCLC) as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ALK", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 10, "feature_type": "rearrangement" } ], "last_updated": "2024-03-04", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Xalkori (crizotinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2011/202570s000lbl.pdf. Revised August 2011. Accessed March 4, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 8, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2011/202570s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Crizotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 11, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for lorbrena for patients with ALK positive metastatic non-small cell lung cancer (NSCLC) for second- or third-line treatment. Continued approval for this indication may be contingent upon veritifcation and description of clinical benefit in a confirmatory trial.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ALK", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 11, "feature_type": "rearrangement" } ], "last_updated": "2020-11-12", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Lorbrena (lorlatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/210868s001lbl.pdf. Revised May 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 9, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/210868s001lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Lorlatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ALK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 12, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted regular approval for ceritinib for patients with for patients with metastatic non-small cell lung cancer (NSCLC) whose tumors are anaplastic lymphoma kinase (ALK)-positive as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ALK", "gene2": null, "locus": null, "rearrangement_type": null } ], "feature_id": 12, "feature_type": "rearrangement" } ], "last_updated": "2020-11-12", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Zykadia (ceritinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/211225s000lbl.pdf. Revised March 2019. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 10, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/211225s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ceritinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ALK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 13, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Alectinib (Alecensa) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option as a first or subsequent line of therapy for patients with metastatic non-small cell lung cancer whose tumors harbor an ALK rearrangement", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ALK", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 13, "feature_type": "rearrangement" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.5.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12, 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 11, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Alectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ALK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 14, "context": "Advanced", "created_on": "05/07/26", "deprecated": false, "description": "Ceritinib was highly active in patients with advanced, ALK-rearranged NSCLC, including those who had had disease progression during crizotinib treatment, regardless of the presence of resistance mutations in ALK.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ALK", "gene2": null, "locus": null, "rearrangement_type": null } ], "feature_id": 14, "feature_type": "rearrangement" } ], "last_updated": "2019-08-10", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Shaw AT, Kim DW, Mehra R, et al. Ceritinib in ALK-rearranged non-small-cell lung cancer. N Engl J Med. 2014;370(13):1189-97.", "doi": "10.1056/NEJMoa1311107", "nct": "NCT01283516", "pmid": 24670165, "source_id": 12, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1311107" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ceritinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ALK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 15, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Crizotinib (Xalkori) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with inflammatory myofibroblastic tumors and ALK translocations.", "disease": "Inflammatory Myofibroblastic Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ALK", "gene2": null, "locus": null, "rearrangement_type": "Translocation" } ], "feature_id": 15, "feature_type": "rearrangement" } ], "last_updated": "2023-11-02", "oncotree_code": "IMT", "oncotree_term": "Inflammatory Myofibroblastic Tumor", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Soft Tissue Sarcoma V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 10th, 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 13, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/sarcoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Crizotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 16, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Ceritinib (Zykadia) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with inflammatory myofibroblastic tumors and ALK translocations.", "disease": "Inflammatory Myofibroblastic Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ALK", "gene2": null, "locus": null, "rearrangement_type": "Translocation" } ], "feature_id": 16, "feature_type": "rearrangement" } ], "last_updated": "2023-11-02", "oncotree_code": "IMT", "oncotree_term": "Inflammatory Myofibroblastic Tumor", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Soft Tissue Sarcoma V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 10th, 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 13, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/sarcoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ceritinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ALK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 17, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A sustained partial response is observed ot the ALK inhibitor crizotinib in a patient with ALK-translocated IMT, as compared with no observed activity in another patient without the ALK translocation.", "disease": "Inflammatory Myofibroblastic Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ALK", "gene2": null, "locus": null, "rearrangement_type": "Translocation" } ], "feature_id": 17, "feature_type": "rearrangement" } ], "last_updated": "2019-08-10", "oncotree_code": "IMT", "oncotree_term": "Inflammatory Myofibroblastic Tumor", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Butrynski JE, D'adamo DR, Hornick JL, et al. Crizotinib in ALK-rearranged inflammatory myofibroblastic tumor. N Engl J Med. 2010;363(18):1727-33.", "doi": "10.1056/NEJMoa1007056", "nct": "NCT00585195", "pmid": 20979472, "source_id": 14, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1007056" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Crizotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 18, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "BET inhibition was found to have an antitumor effect in a murine model of squamous cell carcinoma.", "disease": "Squamous Cell Carcinoma, NOS", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BRD4", "gene2": null, "locus": "t(15;19)", "rearrangement_type": "Translocation" } ], "feature_id": 18, "feature_type": "rearrangement" } ], "last_updated": "2018-09-14", "oncotree_code": "SCCNOS", "oncotree_term": "Squamous Cell Carcinoma, NOS", "predictive_implication": "Preclinical", "sources": [ { "citation": "Filippakopoulos P, Qi J, Picaud S, et al. Selective inhibition of BET bromodomains. Nature. 2010;468(7327):1067-73.", "doi": "10.1038/nature09504", "nct": "", "pmid": 20871596, "source_id": 15, "source_type": "Journal", "url": "https://doi.org/10.1038/nature09504" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "JQ1", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "BET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 19, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Palbociclib is predicted to have antitumor effects in multiple myeloma patients with t(11;14) resulting in CCND1 overexpression.", "disease": "Multiple Myeloma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "CCND1", "gene2": null, "locus": "t(11;14)", "rearrangement_type": "Translocation" } ], "feature_id": 19, "feature_type": "rearrangement" } ], "last_updated": "2017-11-03", "oncotree_code": "MM", "oncotree_term": "Multiple Myeloma", "predictive_implication": "Inferential", "sources": [ { "citation": "Manier S, Salem KZ, Park J, Landau DA, Getz G, Ghobrial IM. Genomic complexity of multiple myeloma and its clinical implications. Nat Rev Clin Oncol. 2017;14(2):100-113.", "doi": "10.1038/nrclinonc.2016.122", "nct": "", "pmid": 27531699, "source_id": 16, "source_type": "Journal", "url": "https://doi.org/10.1038/nrclinonc.2016.122" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Palbociclib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CDK4/6 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 20, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In a meta-analysis of 1,661 patients, the t(11;14) translocation accompanied by CCND1 mutation was found to be associated with poor prognosis.", "disease": "Multiple Myeloma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "CCND1", "gene2": null, "locus": "t(11;14)", "rearrangement_type": "Translocation" } ], "feature_id": 20, "feature_type": "rearrangement" } ], "last_updated": "2017-11-03", "oncotree_code": "MM", "oncotree_term": "Multiple Myeloma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Weinhold N, Johnson DC, Chubb D, et al. The CCND1 c.870G>A polymorphism is a risk factor for t(11;14)(q13;q32) multiple myeloma. Nat Genet. 2013;45(5):522-5.", "doi": "10.1038/ng.2583", "nct": "", "pmid": 23502783, "source_id": 17, "source_type": "Journal", "url": "https://doi.org/10.1038/ng.2583" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 21, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Palbociclib is predicted to have antitumor effects in multiple myeloma patients with t(6;14) resulting in CCND3 overexpression.", "disease": "Multiple Myeloma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "CCND3", "gene2": null, "locus": "t(6;14)", "rearrangement_type": "Translocation" } ], "feature_id": 21, "feature_type": "rearrangement" } ], "last_updated": "2017-11-03", "oncotree_code": "MM", "oncotree_term": "Multiple Myeloma", "predictive_implication": "Inferential", "sources": [ { "citation": "Manier S, Salem KZ, Park J, Landau DA, Getz G, Ghobrial IM. Genomic complexity of multiple myeloma and its clinical implications. Nat Rev Clin Oncol. 2017;14(2):100-113.", "doi": "10.1038/nrclinonc.2016.122", "nct": "", "pmid": 27531699, "source_id": 16, "source_type": "Journal", "url": "https://doi.org/10.1038/nrclinonc.2016.122" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Palbociclib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CDK4/6 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 22, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with localized or metastatic dermatofibrosarcoma tumors containing t(17;22)(q22;q13).", "disease": "Dermatofibrosarcoma Protuberans", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "COL1A1", "gene2": "PDGFB", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 22, "feature_type": "rearrangement" } ], "last_updated": "2023-11-02", "oncotree_code": "DFSP", "oncotree_term": "Dermatofibrosarcoma Protuberans", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Dermatofibrosarcoma V.1.2017. \u00a9 National Comprehensive Cancer Network, Inc. 2017. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 18, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/dfsp_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PDGF-R inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 23, "context": "Intracranial metastases", "created_on": "05/07/26", "deprecated": false, "description": "In a retrospective study of patients with NSCLC, tumors with EGFR mutations or EML4-ALK locations had improved in-field local control of brain metastases treated with gamma knife.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "EML4", "gene2": "ALK", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 23, "feature_type": "rearrangement" } ], "last_updated": "2019-08-09", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Johung, Kimberly L. A Clinical Model for Identifying Radiosensitive Tumor Genotypes in Non-Small Cell Lung Cancer. Clin Cancer Res. 2013 Oct 1;19(19):5523-32.", "doi": "10.1158/1078-0432.CCR-13-0836", "nct": "", "pmid": 23897899, "source_id": 19, "source_type": "Journal", "url": "https://clincancerres.aacrjournals.org/content/19/19/5523.long" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Gamma knife", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 24, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Crizotinib (Xalkori) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option as a first or subsequent line of therapy for patients with metastatic non-small cell lung cancer whose tumors harbor an ALK rearrangement, notable with EML4.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "EML4", "gene2": "ALK", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 24, "feature_type": "rearrangement" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.1.2017. \u00a9 National Comprehensive Cancer Network, Inc. 2017. All rights reserved. Accessed November 5, 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 20, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Crizotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 25, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Rearrangements in BRAF are rare but may result in dependencies that can be targeted with RAF and MAP2K1 inhibitors.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ESRP1", "gene2": "RAF1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 25, "feature_type": "rearrangement" } ], "last_updated": "2019-03-07", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Palanisamy N, Ateeq B, Kalyana-sundaram S, et al. Rearrangements of the RAF kinase pathway in prostate cancer, gastric cancer and melanoma. Nat Med. 2010;16(7):793-8.", "doi": "10.1038/nm.2166", "nct": "", "pmid": 20526349, "source_id": 21, "source_type": "Journal", "url": "https://doi.org/10.1038/nm.2166" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Sorafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 26, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Rearrangements in BRAF are rare but may result in dependencies that can be targeted with RAF and MAP2K1 inhibitors.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ESRP1", "gene2": "RAF1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 26, "feature_type": "rearrangement" } ], "last_updated": "2019-03-07", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Palanisamy N, Ateeq B, Kalyana-sundaram S, et al. Rearrangements of the RAF kinase pathway in prostate cancer, gastric cancer and melanoma. Nat Med. 2010;16(7):793-8.", "doi": "10.1038/nm.2166", "nct": "", "pmid": 20526349, "source_id": 21, "source_type": "Journal", "url": "https://doi.org/10.1038/nm.2166" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "U0126", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 27, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "EWS-FLI1 translocations may be associated with improved prognosis in Ewing's Sarcoma; however, current treatments result in patient outcomes indistinguishable by EWS-FLI1 status.", "disease": "Ewing Sarcoma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "EWSR1", "gene2": "FLI1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 27, "feature_type": "rearrangement" } ], "last_updated": "2017-11-03", "oncotree_code": "ES", "oncotree_term": "Ewing Sarcoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Bone Cancer V.1.2017. \u00a9 National Comprehensive Cancer Network, Inc. 2017. All rights reserved. Accessed November 6 2016]. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 22, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/bone.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 28, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "After progressing on previous treatments, a patient with a FGFR2-TACC3 fusion obtained stable disease after being treated with ponatinib.", "disease": "Cholangiocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "FGFR2", "gene2": "TACC3", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 28, "feature_type": "rearrangement" } ], "last_updated": "2017-11-03", "oncotree_code": "CHOL", "oncotree_term": "Cholangiocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Borad MJ, Champion MD, Egan JB, et al. Integrated genomic characterization reveals novel, therapeutically relevant drug targets in FGFR and EGFR pathways in sporadic intrahepatic cholangiocarcinoma. PLoS Genet. 2014;10(2):e1004135.", "doi": "10.1371/journal.pgen.1004135", "nct": "", "pmid": 24550739, "source_id": 23, "source_type": "Journal", "url": "https://doi.org/10.1371/journal.pgen.1004135" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ponatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 29, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administraton (FDA) granted accelerated approval to Pemazyre (pemigatinib). Pemigatinib is a kinase inhibitor indicated for the treatment of adults with previously treated, unresectable locally advanced or metastatic cholangiocarcinoma with a fibroblast growth factor 2 (FGFR2) fusion or rearrangement as detected by an FDA-approved test.", "disease": "Cholangiocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "FGFR2", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 29, "feature_type": "rearrangement" } ], "last_updated": "2020-10-15", "oncotree_code": "CHOL", "oncotree_term": "Cholangiocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Incyte Corporation. Pemazyre (pemigatinib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/213736s000lbl.pdf. Revised April 2020. Accessed October 15th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 24, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/213736s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pemigatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 30, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administraton (FDA) granted accelerated approval to Pemazyre (pemigatinib). Pemigatinib is a kinase inhibitor indicated for the treatment of adults with previously treated, unresectable locally advanced or metastatic cholangiocarcinoma with a fibroblast growth factor 2 (FGFR2) fusion or rearrangement as detected by an FDA-approved test.", "disease": "Cholangiocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "FGFR2", "gene2": null, "locus": null, "rearrangement_type": null } ], "feature_id": 30, "feature_type": "rearrangement" } ], "last_updated": "2020-10-15", "oncotree_code": "CHOL", "oncotree_term": "Cholangiocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Incyte Corporation. Pemazyre (pemigatinib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/213736s000lbl.pdf. Revised April 2020. Accessed October 15th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 24, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/213736s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pemigatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 31, "context": "Adults with previously treated, unresectable locally advanced or metastatic disease", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to infigratinib (Truseltiq, QED Therapeutics, Inc.). Infigratinib is a kinase inhibitor for adults with previously treated, unresectable locally advanced or metastatic cholangiocarcinoma with a fibroblast growth factor receptor 2 (FGFR2) fusion or other rearrangement as detected by an FDA-approved test.", "disease": "Cholangiocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "FGFR2", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 31, "feature_type": "rearrangement" } ], "last_updated": "2021-06-01", "oncotree_code": "CHOL", "oncotree_term": "Cholangiocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "QED Therapeutics, Inc. TRUSELTIQ (infigratinib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2021/214622s000lbl.pdf. Revised May 2021. Accessed June 1st, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 25, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/214622s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Infigratinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 32, "context": "Locally advanced or metastatic.", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to erdafitinib for the treatment of adult patients with locally advanced or metastatic urothelial carcinoma with susceptible FGFR3 genetic alterations, and has progressed during or following at least one line of systemic therapy, as determined by an FDA-approved companion diagnostic. Erdafitinib is not recommended for the treatment of patients who are eligible for and have not received prior PD-1 or PD-L1 inhibitor therapy.", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "FGFR3", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 32, "feature_type": "rearrangement" } ], "last_updated": "2024-01-25", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Janssen Products, LP. Balversa (erdafitinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/212018s007s008s009lbl.pdf. Revised January 2024. Accessed January 25, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 26, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/212018s007s008s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Erdafitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 33, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The combination of bortezomib with tandem transplant therapy was associated with increased event-free survival and complete remission duration in multiple myeloma patients.", "disease": "Multiple Myeloma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "FGFR3", "gene2": "NSD2", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 33, "feature_type": "rearrangement" } ], "last_updated": "2017-11-03", "oncotree_code": "MM", "oncotree_term": "Multiple Myeloma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Pineda-roman M, Zangari M, Haessler J, et al. Sustained complete remissions in multiple myeloma linked to bortezomib in total therapy 3: comparison with total therapy 2. Br J Haematol. 2008;140(6):625-34.", "doi": "10.1111/j.1365-2141.2007.06921.x", "nct": "", "pmid": 18302711, "source_id": 27, "source_type": "Journal", "url": "https://doi.org/10.1111/j.1365-2141.2007.06921.x" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bortezomib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Proteasome inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 34, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A translocation between 11 and 14 [t(11;14)] has been reported to be associated with improved survival.", "disease": "Multiple Myeloma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "IGH", "gene2": null, "locus": "t(11;14)(q13;q32)", "rearrangement_type": "Translocation" } ], "feature_id": 34, "feature_type": "rearrangement" } ], "last_updated": "2023-11-02", "oncotree_code": "MM", "oncotree_term": "Multiple Myeloma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Multiple Myeloma V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 28, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/myeloma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 35, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A translocation between 4 and 14 [t(4;14)] has been reported in several studies to be associated with poor prognosis.", "disease": "Multiple Myeloma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "IGH", "gene2": null, "locus": "t(4;14)(q16;q32)", "rearrangement_type": "Translocation" } ], "feature_id": 35, "feature_type": "rearrangement" } ], "last_updated": "2023-11-02", "oncotree_code": "MM", "oncotree_term": "Multiple Myeloma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Multiple Myeloma V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 28, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/myeloma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 36, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for larotrectinib for the treatment of adult and pediatric with solid tumors that have NTRK gene fusions without a known resistance mechanism, are metastatic or surgical resection is likely to result in severe morbidity, and have no satisfactory alternative treatments or have progressed following treatment.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "NTRK1", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 36, "feature_type": "rearrangement" } ], "last_updated": "2025-04-30", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Loxo Oncology, Inc. Vitrakvi (larotrectinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/210861s012lbl.pdf. Revised April 2025. Accessed April 30, 2025.", "doi": "", "nct": "NCT02122913", "pmid": "", "source_id": 29, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/210861s012lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Larotrectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "TRK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 37, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "NTRK fusions may respond to NTRK inhibitors", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "NTRK1", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 37, "feature_type": "rearrangement" } ], "last_updated": "2017-03-16", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Amatu A, Sartore-Bianchi A, Siena S. NTRK gene fusions as novel targets of cancer therapy across multiple tumour types. ESMO Open. 2016;1(2).", "doi": "10.1136/esmoopen-2015-000023", "nct": "", "pmid": 27843590, "source_id": 30, "source_type": "Journal", "url": "https://doi.org/10.1136/esmoopen-2015-000023" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Entrectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "TRK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 38, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval for entrectinib for adult and pediatric patients older than 1 month with solid tumors that have a NTRK gene fusion without a known acquired resistance mutation, are metastatic or where surgical resection is likely to result in severe morbidity, and have progressed following treatment or have no satisfactory standard therapy.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "NTRK1", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 38, "feature_type": "rearrangement" } ], "last_updated": "2023-11-01", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Rozlytrek (entrectinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/212725Orig1s009lbl.pdf. Revised October 2023. Accessed November 1, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 31, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/212725Orig1s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Entrectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "TRK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 39, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for larotrectinib for the treatment of adult and pediatric with solid tumors that have NTRK gene fusions without a known resistance mechanism, are metastatic or surgical resection is likely to result in severe morbidity, and have no satisfactory alternative treatments or have progressed following treatment.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "NTRK2", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 39, "feature_type": "rearrangement" } ], "last_updated": "2025-04-30", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Loxo Oncology, Inc. Vitrakvi (larotrectinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/210861s012lbl.pdf. Revised April 2025. Accessed April 30, 2025.", "doi": "", "nct": "NCT02122913", "pmid": "", "source_id": 29, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/210861s012lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Larotrectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "TRK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 40, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "NTRK fusions may respond to NTRK inhibitors.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "NTRK2", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 40, "feature_type": "rearrangement" } ], "last_updated": "2017-03-16", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Amatu A, Sartore-Bianchi A, Siena S. NTRK gene fusions as novel targets of cancer therapy across multiple tumour types. ESMO Open. 2016;1(2).", "doi": "10.1136/esmoopen-2015-000023", "nct": "", "pmid": 27843590, "source_id": 30, "source_type": "Journal", "url": "https://doi.org/10.1136/esmoopen-2015-000023" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Entrectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "TRK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 41, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval for entrectinib for adult and pediatric patients older than 1 month with solid tumors that have a NTRK gene fusion without a known acquired resistance mutation, are metastatic or where surgical resection is likely to result in severe morbidity, and have progressed following treatment or have no satisfactory standard therapy.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "NTRK2", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 41, "feature_type": "rearrangement" } ], "last_updated": "2023-11-01", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Rozlytrek (entrectinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/212725Orig1s009lbl.pdf. Revised October 2023. Accessed November 1, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 31, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/212725Orig1s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Entrectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "TRK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 42, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for larotrectinib for the treatment of adult and pediatric with solid tumors that have NTRK gene fusions without a known resistance mechanism, are metastatic or surgical resection is likely to result in severe morbidity, and have no satisfactory alternative treatments or have progressed following treatment.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "NTRK3", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 42, "feature_type": "rearrangement" } ], "last_updated": "2025-04-30", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Loxo Oncology, Inc. Vitrakvi (larotrectinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/210861s012lbl.pdf. Revised April 2025. Accessed April 30, 2025.", "doi": "", "nct": "NCT02122913", "pmid": "", "source_id": 29, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/210861s012lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Larotrectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "TRK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 43, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "NTRK fusions may respond to NTRK inhibitors.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "NTRK3", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 43, "feature_type": "rearrangement" } ], "last_updated": "2017-03-16", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Amatu A, Sartore-Bianchi A, Siena S. NTRK gene fusions as novel targets of cancer therapy across multiple tumour types. ESMO Open. 2016;1(2).", "doi": "10.1136/esmoopen-2015-000023", "nct": "", "pmid": 27843590, "source_id": 30, "source_type": "Journal", "url": "https://doi.org/10.1136/esmoopen-2015-000023" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Entrectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "TRK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 44, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval for entrectinib for adult and pediatric patients older than 1 month with solid tumors that have a NTRK gene fusion without a known acquired resistance mutation, are metastatic or where surgical resection is likely to result in severe morbidity, and have progressed following treatment or have no satisfactory standard therapy.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "NTRK3", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 44, "feature_type": "rearrangement" } ], "last_updated": "2023-11-01", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Rozlytrek (entrectinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/212725Orig1s009lbl.pdf. Revised October 2023. Accessed November 1, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 31, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/212725Orig1s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Entrectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "TRK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 45, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for imatinib for myelodysplastic / myeloproliferative diseases (MDS/MPD) associated with PDGFR (platelet-derived growth factor receptor) gene re-arrangements.", "disease": "Myelodysplasia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "PDGFRA", "gene2": null, "locus": null, "rearrangement_type": null } ], "feature_id": 45, "feature_type": "rearrangement" } ], "last_updated": "2020-11-12", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Gleevec (imatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021588s056s057lbl.pdf. Revised August 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 3, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021588s056s057lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PDGF-R inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 46, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for imatinib for adult patients with chronic eosinophilic leukemia (CEL) who have FIP1L1-PDGFRA fusions.", "disease": "Chronic Eosinophilic Leukemia, NOS", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "FIP1L1", "gene2": "PDGFRA", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 46, "feature_type": "rearrangement" } ], "last_updated": "2020-11-12", "oncotree_code": "CELNOS", "oncotree_term": "Chronic Eosinophilic Leukemia, NOS", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Gleevec (imatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021588s056s057lbl.pdf. Revised August 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 3, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021588s056s057lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PDGF-R inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 47, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A patient with a BCR--PDGFRA fusion observed rapid clinical and molecular response to imatinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BCR", "gene2": "PDGFRA", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 47, "feature_type": "rearrangement" } ], "last_updated": "2019-03-19", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Trempat P, Villalva C, Laurent G, et al. Chronic myeloproliferative disorders with rearrangement of the platelet-derived growth factor alpha receptor: a new clinical target for STI571/Glivec Oncogene. 2003; 22(36):5702-5706.", "doi": "10.1038/sj.onc.1206543", "nct": "", "pmid": 12944919, "source_id": 32, "source_type": "Journal", "url": "https://doi.org/10.1038/sj.onc.1206543" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "BCR-ABL inhibition + PDGF-R inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 48, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for imatinib for myelodysplastic/ myeloproliferative diseases (MDS/MPD) associated with PDGFR (platelet-derived growth factor receptor) gene re-arrangements.", "disease": "Myelodysplasia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "PDGFRB", "gene2": null, "locus": null, "rearrangement_type": null } ], "feature_id": 48, "feature_type": "rearrangement" } ], "last_updated": "2020-11-12", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Gleevec (imatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021588s056s057lbl.pdf. Revised August 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 3, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021588s056s057lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PDGF-R inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 49, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with Chronic Myelomonocytic Leukemia harboring an ETV6::PDGFRB translocation.", "disease": "Chronic Myelomonocytic Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ETV6", "gene2": "PDGFRB", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 49, "feature_type": "rearrangement" } ], "last_updated": "2023-11-02", "oncotree_code": "CMML", "oncotree_term": "Chronic Myelomonocytic Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PDGF-R inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 50, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Cabozantinib (Xalkori) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with metastatic non-small cell lung cancer whose tumors harbor a RET rearrangement.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "RET", "gene2": null, "locus": null, "rearrangement_type": null } ], "feature_id": 50, "feature_type": "rearrangement" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.5.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12, 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 11, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cabozantinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 51, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Vandetanib (Caprelsa) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with metastatic non-small cell lung cancer whose tumors harbor a RET rearrangement.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "RET", "gene2": null, "locus": null, "rearrangement_type": null } ], "feature_id": 51, "feature_type": "rearrangement" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.5.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12, 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 11, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vandetanib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 52, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Cabozantinib (a dual MET-VEGF inhibitor) is being evaluated for efficacy in patients with RET fusion-positive tumors.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "RET", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 52, "feature_type": "rearrangement" } ], "last_updated": "2019-01-29", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Drilon A, Wang L, Hasanovic A, et al. Response to Cabozantinib in patients with RET fusion-positive lung adenocarcinomas. Cancer Discov. 2013;3(6):630-5.", "doi": "10.1158/2159-8290.CD-13-0035", "nct": "NCT01639508", "pmid": 23533264, "source_id": 34, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-13-0035" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cabozantinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 53, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to selpercatinib for the treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with a RET gene fusion, as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "RET", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 53, "feature_type": "rearrangement" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Eli Lily and Company. Retevmo (selpercatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/213246s000lbl.pdf. Revised May 2020. Accessed October 22, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 35, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/213246s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selpercatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 54, "context": "Advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to selpercatinib for the treatment of adult and pediatric patients 2 years of age and older with advanced or metastatic thyroid cancer with a RET gene fusion, as detected by an FDA approved test, who require systemic therapy and who are radioactive iodine-refactory (if radioactive iodine is appropriate).", "disease": "Anaplastic Thyroid Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "RET", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 54, "feature_type": "rearrangement" } ], "last_updated": "2025-02-13", "oncotree_code": "THAP", "oncotree_term": "Anaplastic Thyroid Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Eli Lily and Company. Retevmo (selpercatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/213246s009lbl.pdf. Revised June 2024. Accessed July 11, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 36, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/213246s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selpercatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 55, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted regular approval for pralsetinib for adult patients with metastatic rearranged during transfection (RET) fusion-positive non-small cell lung cancer (NSCLC) as detected by an FDA approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "RET", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 55, "feature_type": "rearrangement" } ], "last_updated": "2023-09-06", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Blueprint Medicines Corporation. Gavreto (pralsetinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/213721s009lbl.pdf. Revised August 2023. Accessed September 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 37, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/213721s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pralsetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 56, "context": "Advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration granted accelerated approval to pralsetinib for adult and pediatric patients 12 years of age and older with advanced or metastatic RET fusion-positive thyroid cancer who require systemic therapy or who are radioactive iodine-refractory (if radioactive iodine is appropriate).", "disease": "Anaplastic Thyroid Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "RET", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 56, "feature_type": "rearrangement" } ], "last_updated": "2020-12-03", "oncotree_code": "THAP", "oncotree_term": "Anaplastic Thyroid Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Blueprint Medicines Corporation. Gavreto (pralsetinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/214701s000lbl.pdf. Revised 12/2020. Accessed December 3, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 38, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/214701s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pralsetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 57, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for crizotinib for the treatment of patients with ROS positive metastatic non-small cell lung cancer (NSCLC).", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ROS1", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 57, "feature_type": "rearrangement" } ], "last_updated": "2024-03-04", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Xalkori (crizotinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2016/202570s016lbl.pdf. Revised March 2016. Accessed March 4, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 39, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2016/202570s016lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Crizotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 59, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Azacitidine (Vidaza) in combination with Panobinostat (Farydak) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with myelodysplasia syndromes harboring a t(8;21)(q22;q22) translocation. t(8;21)(q22;q22) results in the expression of fusion protein RUNX1-RUNX1T1, which recruits histone deacetylases (HDAC) to silence RUNX1 target genes (such as IL-3). Combined use of HDAC inhibitors and DNMT inhibitors may rescue RUNX1 target genes.", "disease": "Myelodysplasia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "RUNX1", "gene2": "RUNX1T1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 59, "feature_type": "rearrangement" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Preclinical", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": 15735013, "source_id": 41, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Azacitidine + Panobinostat", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Hypomethylating agent chemotherapy + HDAC inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 60, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Rearrangements in BRAF are rare but may result in dependencies that can be targeted with RAF and MAP2K1 inhibitors.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "SLC45A3", "gene2": "BRAF", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 60, "feature_type": "rearrangement" } ], "last_updated": "2019-03-07", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Palanisamy N, Ateeq B, Kalyana-sundaram S, et al. Rearrangements of the RAF kinase pathway in prostate cancer, gastric cancer and melanoma. Nat Med. 2010;16(7):793-8.", "doi": "10.1038/nm.2166", "nct": "", "pmid": 20526349, "source_id": 21, "source_type": "Journal", "url": "https://doi.org/10.1038/nm.2166" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Sorafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 61, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Rearrangements in BRAF are rare but may result in dependencies that can be targeted with RAF and MAP2K1 inhibitors.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "SLC45A3", "gene2": "BRAF", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 61, "feature_type": "rearrangement" } ], "last_updated": "2019-03-07", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Palanisamy N, Ateeq B, Kalyana-sundaram S, et al. Rearrangements of the RAF kinase pathway in prostate cancer, gastric cancer and melanoma. Nat Med. 2010;16(7):793-8.", "doi": "10.1038/nm.2166", "nct": "", "pmid": 20526349, "source_id": 21, "source_type": "Journal", "url": "https://doi.org/10.1038/nm.2166" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "U0126", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 62, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Cells which harbored the TMPRSS2-ERG fusion became radiosensitive following radiation and PARP inhibitor, specifically Rucaparib.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "TMPRSS2", "gene2": "ERG", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 62, "feature_type": "rearrangement" } ], "last_updated": "2017-11-03", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Chatterjee P, Choudhary GS, Sharma A, et al. PARP inhibition sensitizes to low dose-rate radiation TMPRSS2-ERG fusion gene-expressing and PTEN-deficient prostate cancer cells. PLoS ONE. 2013;8(4):e60408.", "doi": "10.1371/journal.pone.0060408", "nct": "", "pmid": 23565244, "source_id": 42, "source_type": "Journal", "url": "https://doi.org/10.1371/journal.pone.0060408" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Rucaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 63, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A cohort of men with localized prostate cancer was followed and a statistically significant association between the presense of the TMPRSS2-ERG fusion and prostate cancer specific death was observed. Prostate cancer with this fusion may be of a more aggressive phenotype.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "TMPRSS2", "gene2": "ERG", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 63, "feature_type": "rearrangement" } ], "last_updated": "2017-11-03", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Demichelis F, Fall K, Perner S, et al. TMPRSS2:ERG gene fusion associated with lethal prostate cancer in a watchful waiting cohort. Oncogene. 2007;26(31):4596-9.", "doi": "10.1038/sj.onc.1210237", "nct": "", "pmid": 17237811, "source_id": 43, "source_type": "Journal", "url": "https://doi.org/10.1038/sj.onc.1210237" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 64, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "ETS fusions did not have a better response to AR suppression and PARP inhibition.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "TMPRSS2", "gene2": "ERG", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 64, "feature_type": "rearrangement" } ], "last_updated": "2019-01-29", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Hussain M, Daignault-newton S, Twardowski PW, et al. Targeting Androgen Receptor and DNA Repair in Metastatic Castration-Resistant Prostate Cancer: Results From NCI 9012. J Clin Oncol. 2018;36(10):991-999.", "doi": "10.1200/JCO.2017.75.7310", "nct": "NCT01576172", "pmid": 29261439, "source_id": 44, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2017.75.7310" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "Antiandrogen", "therapy_type": "Hormone therapy", "validated": true }, { "assertion_id": 65, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "ETS fusions did not have a better response to AR suppression and PARP inhibition.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "TMPRSS2", "gene2": "ERG", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 65, "feature_type": "rearrangement" } ], "last_updated": "2019-01-29", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Hussain M, Daignault-newton S, Twardowski PW, et al. Targeting Androgen Receptor and DNA Repair in Metastatic Castration-Resistant Prostate Cancer: Results From NCI 9012. J Clin Oncol. 2018;36(10):991-999.", "doi": "10.1200/JCO.2017.75.7310", "nct": "NCT01576172", "pmid": 29261439, "source_id": 44, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2017.75.7310" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Veliparib", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 66, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "T315I mutant ABL1 in p210 BCR-ABL cells resulted in retained high levels of phosphotyrosine at increasing concentrations of inhibitor STI-571, whereas wildtype appropriately received inhibition.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.944C>T", "chromosome": "9", "end_position": "133748283", "exon": "5", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.T315I", "reference_allele": "C", "rsid": "rs121913459", "start_position": "133748283", "variant_annotation": "Missense" } ], "feature_id": 66, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-30", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Preclinical", "sources": [ { "citation": "Gorre, Mercedes E., et al. Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification. Science 293.5531 (2001): 876-880.", "doi": "10.1126/science.1062538", "nct": "", "pmid": 11423618, "source_id": 45, "source_type": "Journal", "url": "https://doi.org/10.1126/science.1062538" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 67, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BCR-ABL may suggest resistance to imatinib in CML. ABL [T315I, V299L, T315A, F317L/V/I/C] are known to be less sensitive to dasatinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "9", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 67, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. (2011) Bcr-Abl kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inihibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood: blood-2010-2012-326405", "doi": "10.1182/blood-2010-12-326405", "nct": "", "pmid": 27760149, "source_id": 46, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2010-12-326405" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 68, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BCR-ABL may suggest resistance to imatinib in CML. ABL [T315I, V299L, T315A, F317L/V/I/C] are known to be less sensitive to dasatinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.943A>G", "chromosome": "9", "end_position": "133747582", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.T315A", "reference_allele": "A", "rsid": "rs1057519772", "start_position": "133747582", "variant_annotation": "Missense" } ], "feature_id": 68, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. (2011) Bcr-Abl kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inihibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood: blood-2010-2012-326405", "doi": "10.1182/blood-2010-12-326405", "nct": "", "pmid": 27760149, "source_id": 46, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2010-12-326405" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 69, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BCR-ABL may suggest resistance to imatinib in CML. ABL [T315I, V299L, T315A, F317L/V/I/C] are known to be less sensitive to dasatinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.944C>T", "chromosome": "9", "end_position": "133748283", "exon": "5", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.T315I", "reference_allele": "C", "rsid": "rs121913459", "start_position": "133748283", "variant_annotation": "Missense" } ], "feature_id": 69, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-30", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. (2011) Bcr-Abl kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inihibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood: blood-2010-2012-326405", "doi": "10.1182/blood-2010-12-326405", "nct": "", "pmid": 27760149, "source_id": 46, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2010-12-326405" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 70, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BCR-ABL may suggest resistance to imatinib in CML. ABL [T315I, V299L, T315A, F317L/V/I/C] are known to be less sensitive to dasatinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.951C>G", "chromosome": "9", "end_position": "133748290", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F317L", "reference_allele": "C", "rsid": null, "start_position": "133748290", "variant_annotation": "Missense" } ], "feature_id": 70, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. (2011) Bcr-Abl kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inihibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood: blood-2010-2012-326405", "doi": "10.1182/blood-2010-12-326405", "nct": "", "pmid": 27760149, "source_id": 46, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2010-12-326405" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 71, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BCR-ABL may suggest resistance to imatinib in CML. ABL [T315I, V299L, T315A, F317L/V/I/C] are known to be less sensitive to dasatinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.949T>G", "chromosome": "9", "end_position": "133748288", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F317V", "reference_allele": "T", "rsid": "rs1057519773", "start_position": "133748288", "variant_annotation": "Missense" } ], "feature_id": 71, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. (2011) Bcr-Abl kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inihibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood: blood-2010-2012-326405", "doi": "10.1182/blood-2010-12-326405", "nct": "", "pmid": 27760149, "source_id": 46, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2010-12-326405" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 72, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BCR-ABL may suggest resistance to imatinib in CML. ABL [T315I, V299L, T315A, F317L/V/I/C] are known to be less sensitive to dasatinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.949T>A", "chromosome": "9", "end_position": "133748288", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F317I", "reference_allele": "T", "rsid": "rs1057519773", "start_position": "133748288", "variant_annotation": "Missense" } ], "feature_id": 72, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. (2011) Bcr-Abl kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inihibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood: blood-2010-2012-326405", "doi": "10.1182/blood-2010-12-326405", "nct": "", "pmid": 27760149, "source_id": 46, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2010-12-326405" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 73, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BCR-ABL may suggest resistance to imatinib in CML. ABL [T315I, V299L, T315A, F317L/V/I/C] are known to be less sensitive to dasatinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.950T>G", "chromosome": "9", "end_position": "133747586", "exon": "5", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F317C", "reference_allele": "T", "rsid": null, "start_position": "133747586", "variant_annotation": "Missense" } ], "feature_id": 73, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. (2011) Bcr-Abl kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inihibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood: blood-2010-2012-326405", "doi": "10.1182/blood-2010-12-326405", "nct": "", "pmid": 27760149, "source_id": 46, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2010-12-326405" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 74, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BCR-ABL may suggest resistance to imatinib in CML.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "9", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 74, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. (2011) Bcr-Abl kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inihibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood: blood-2010-2012-326405", "doi": "10.1182/blood-2010-12-326405", "nct": "", "pmid": 27760149, "source_id": 46, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2010-12-326405" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 75, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BCR-ABL may suggest resistance to imatinib in CML. ABL [E255K/V, Y253H, F359V/C/I] are known to be less sensitive to Nilotinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.763G>A", "chromosome": "9", "end_position": "133738306", "exon": "4", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.E255K", "reference_allele": "G", "rsid": "rs387906517", "start_position": "133738306", "variant_annotation": "Missense" } ], "feature_id": 75, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. (2011) Bcr-Abl kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inihibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood: blood-2010-2012-326405", "doi": "10.1182/blood-2010-12-326405", "nct": "", "pmid": 27760149, "source_id": 46, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2010-12-326405" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nilotinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 76, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BCR-ABL may suggest resistance to imatinib in CML. ABL [E255K/V, Y253H, F359V/C/I] are known to be less sensitive to Nilotinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.764A>T", "chromosome": "9", "end_position": "133738307", "exon": "4", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.E255V", "reference_allele": "A", "rsid": "rs387906516", "start_position": "133738307", "variant_annotation": "Missense" } ], "feature_id": 76, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. (2011) Bcr-Abl kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inihibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood: blood-2010-2012-326405", "doi": "10.1182/blood-2010-12-326405", "nct": "", "pmid": 27760149, "source_id": 46, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2010-12-326405" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nilotinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 77, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BCR-ABL may suggest resistance to imatinib in CML. ABL [E255K/V, Y253H, F359V/C/I] are known to be less sensitive to Nilotinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.757T>C", "chromosome": "9", "end_position": "133738357", "exon": "4", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.Y253H", "reference_allele": "T", "rsid": "rs121913461", "start_position": "133738357", "variant_annotation": "Missense" } ], "feature_id": 77, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. (2011) Bcr-Abl kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inihibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood: blood-2010-2012-326405", "doi": "10.1182/blood-2010-12-326405", "nct": "", "pmid": 27760149, "source_id": 46, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2010-12-326405" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nilotinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 78, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BCR-ABL may suggest resistance to imatinib in CML. ABL [E255K/V, Y253H, F359V/C/I] are known to be less sensitive to Nilotinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1075T>G", "chromosome": "9", "end_position": "133748414", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F359V", "reference_allele": "T", "rsid": "rs121913452", "start_position": "133748414", "variant_annotation": "Missense" } ], "feature_id": 78, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. (2011) Bcr-Abl kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inihibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood: blood-2010-2012-326405", "doi": "10.1182/blood-2010-12-326405", "nct": "", "pmid": 27760149, "source_id": 46, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2010-12-326405" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nilotinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 79, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BCR-ABL may suggest resistance to imatinib in CML. ABL [E255K/V, Y253H, F359V/C/I] are known to be less sensitive to Nilotinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1076T>G", "chromosome": "9", "end_position": "133748358", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F359C", "reference_allele": "T", "rsid": null, "start_position": "133748358", "variant_annotation": "Missense" } ], "feature_id": 79, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. (2011) Bcr-Abl kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inihibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood: blood-2010-2012-326405", "doi": "10.1182/blood-2010-12-326405", "nct": "", "pmid": 27760149, "source_id": 46, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2010-12-326405" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nilotinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 80, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BCR-ABL may suggest resistance to imatinib in CML. ABL [E255K/V, Y253H, F359V/C/I] are known to be less sensitive to Nilotinib.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.1075T>A", "chromosome": "9", "end_position": "133748414", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F359I", "reference_allele": "T", "rsid": "rs121913452", "start_position": "133748414", "variant_annotation": "Missense" } ], "feature_id": 80, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. (2011) Bcr-Abl kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inihibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood: blood-2010-2012-326405", "doi": "10.1182/blood-2010-12-326405", "nct": "", "pmid": 27760149, "source_id": 46, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2010-12-326405" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nilotinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 81, "context": "Advanced", "created_on": "05/07/26", "deprecated": false, "description": "Dasatinib (Sprycel) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.757T>C", "chromosome": "9", "end_position": "133738357", "exon": "4", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.Y253H", "reference_allele": "T", "rsid": "rs121913461", "start_position": "133738357", "variant_annotation": "Missense" } ], "feature_id": 81, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 82, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Dasatinib (Sprycel) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.763G>A", "chromosome": "9", "end_position": "133738306", "exon": "4", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.E255K", "reference_allele": "G", "rsid": "rs387906517", "start_position": "133738306", "variant_annotation": "Missense" } ], "feature_id": 82, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 83, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Dasatinib (Sprycel) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.764A>T", "chromosome": "9", "end_position": "133738307", "exon": "4", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.E255V", "reference_allele": "A", "rsid": "rs387906516", "start_position": "133738307", "variant_annotation": "Missense" } ], "feature_id": 83, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 84, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Dasatinib (Sprycel) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1075T>G", "chromosome": "9", "end_position": "133748414", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F359V", "reference_allele": "T", "rsid": "rs121913452", "start_position": "133748414", "variant_annotation": "Missense" } ], "feature_id": 84, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 85, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Dasatinib (Sprycel) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1076T>G", "chromosome": "9", "end_position": "133748358", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F359C", "reference_allele": "T", "rsid": null, "start_position": "133748358", "variant_annotation": "Missense" } ], "feature_id": 85, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 86, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Dasatinib (Sprycel) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.1075T>A", "chromosome": "9", "end_position": "133748414", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F359I", "reference_allele": "T", "rsid": "rs121913452", "start_position": "133748414", "variant_annotation": "Missense" } ], "feature_id": 86, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 87, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Nilotinib (Tasigna) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.951C>G", "chromosome": "9", "end_position": "133748290", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F317L", "reference_allele": "C", "rsid": null, "start_position": "133748290", "variant_annotation": "Missense" } ], "feature_id": 87, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nilotinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 88, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Nilotinib (Tasigna) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.949T>G", "chromosome": "9", "end_position": "133748288", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F317V", "reference_allele": "T", "rsid": "rs1057519773", "start_position": "133748288", "variant_annotation": "Missense" } ], "feature_id": 88, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nilotinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 89, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Nilotinib (Tasigna) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.949T>A", "chromosome": "9", "end_position": "133748288", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F317I", "reference_allele": "T", "rsid": "rs1057519773", "start_position": "133748288", "variant_annotation": "Missense" } ], "feature_id": 89, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nilotinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 90, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Nilotinib (Tasigna) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.950T>G", "chromosome": "9", "end_position": "133747586", "exon": "5", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F317C", "reference_allele": "T", "rsid": null, "start_position": "133747586", "variant_annotation": "Missense" } ], "feature_id": 90, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nilotinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 91, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Nilotinib (Tasigna) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.943A>G", "chromosome": "9", "end_position": "133747582", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.T315A", "reference_allele": "A", "rsid": "rs1057519772", "start_position": "133747582", "variant_annotation": "Missense" } ], "feature_id": 91, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nilotinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 92, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Nilotinib (Tasigna) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.895G>T", "chromosome": "9", "end_position": "133747531", "exon": "5", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.V299L", "reference_allele": "G", "rsid": null, "start_position": "133747531", "variant_annotation": "Missense" } ], "feature_id": 92, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nilotinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 93, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Bosutinib (Bosulif) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.763G>A", "chromosome": "9", "end_position": "133738306", "exon": "4", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.E255K", "reference_allele": "G", "rsid": "rs387906517", "start_position": "133738306", "variant_annotation": "Missense" } ], "feature_id": 93, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bosutinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 94, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Bosutinib (Bosulif) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.764A>T", "chromosome": "9", "end_position": "133738307", "exon": "4", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.E255V", "reference_allele": "A", "rsid": "rs387906516", "start_position": "133738307", "variant_annotation": "Missense" } ], "feature_id": 94, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bosutinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 95, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Bosutinib (Bosulif) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.951C>G", "chromosome": "9", "end_position": "133748290", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F317L", "reference_allele": "C", "rsid": null, "start_position": "133748290", "variant_annotation": "Missense" } ], "feature_id": 95, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bosutinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 96, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Bosutinib (Bosulif) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.949T>G", "chromosome": "9", "end_position": "133748288", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F317V", "reference_allele": "T", "rsid": "rs1057519773", "start_position": "133748288", "variant_annotation": "Missense" } ], "feature_id": 96, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bosutinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 97, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Bosutinib (Bosulif) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.949T>A", "chromosome": "9", "end_position": "133748288", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F317I", "reference_allele": "T", "rsid": "rs1057519773", "start_position": "133748288", "variant_annotation": "Missense" } ], "feature_id": 97, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bosutinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 98, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Bosutinib (Bosulif) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.950T>G", "chromosome": "9", "end_position": "133747586", "exon": "5", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F317C", "reference_allele": "T", "rsid": null, "start_position": "133747586", "variant_annotation": "Missense" } ], "feature_id": 98, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bosutinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 99, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Bosutinib (Bosulif) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1075T>G", "chromosome": "9", "end_position": "133748414", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F359V", "reference_allele": "T", "rsid": "rs121913452", "start_position": "133748414", "variant_annotation": "Missense" } ], "feature_id": 99, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bosutinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 100, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Bosutinib (Bosulif) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1076T>G", "chromosome": "9", "end_position": "133748358", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F359C", "reference_allele": "T", "rsid": null, "start_position": "133748358", "variant_annotation": "Missense" } ], "feature_id": 100, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bosutinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 101, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Bosutinib (Bosulif) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.943A>G", "chromosome": "9", "end_position": "133747582", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.T315A", "reference_allele": "A", "rsid": "rs1057519772", "start_position": "133747582", "variant_annotation": "Missense" } ], "feature_id": 101, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bosutinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 102, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Bosutinib (Bosulif) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.757T>C", "chromosome": "9", "end_position": "133738357", "exon": "4", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.Y253H", "reference_allele": "T", "rsid": "rs121913461", "start_position": "133738357", "variant_annotation": "Missense" } ], "feature_id": 102, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bosutinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 103, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Ponatinib (Iclusig) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.944C>T", "chromosome": "9", "end_position": "133748283", "exon": "5", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.T315I", "reference_allele": "C", "rsid": "rs121913459", "start_position": "133748283", "variant_annotation": "Missense" } ], "feature_id": 103, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-30", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ponatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 104, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Omacetaxine is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.944C>T", "chromosome": "9", "end_position": "133748283", "exon": "5", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.T315I", "reference_allele": "C", "rsid": "rs121913459", "start_position": "133748283", "variant_annotation": "Missense" } ], "feature_id": 104, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-30", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Omacetaxine", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 105, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Dasatinib (Sprycel) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with CML in the context of secondary resistance variants. Selection of an alternate TKI in the context of TKI-resistant or possible-TKI resistant BCR::ABL1 mutant CML may be based on mutantion profile.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.1075T>A", "chromosome": "9", "end_position": "133748414", "exon": "6", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.F359I", "reference_allele": "T", "rsid": "rs121913452", "start_position": "133748414", "variant_annotation": "Missense" } ], "feature_id": 105, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Chronic Myelogenous Leukemia V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed August 9 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 47, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cml_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dasatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 106, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Activating mutations in AKT may predict sensitivity to direct inhibition or downstream inhibition of the PI3K/mTOR pathway. This study observed that AKT inhibitors MK-2206 and AZD5363 both caused significant growth inhibition of breast cancer explant models with AKT1 E17K mutations.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "14", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "AKT1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 106, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Davies BR, Guan N, Logie A, et al. Tumors with AKT1 E17K Mutations Are Rational Targets for Single Agent or Combination Therapy with AKT Inhibitors. Mol Cancer Ther. 2015;14(11):2441-51.", "doi": "10.1158/1535-7163.MCT-15-0230", "nct": "", "pmid": 26351323, "source_id": 48, "source_type": "Journal", "url": "https://doi.org/10.1158/1535-7163.MCT-15-0230" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Akt Inhibitor MK2206", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 107, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Activating mutations in AKT may predict sensitivity to direct inhibition or downstream inhibition of the PI3K/mTOR pathway. This study observed that AKT inhibitors MK-2206 and AZD5363 both caused significant growth inhibition of breast cancer explant models with AKT1 E17K mutations.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.49G>A", "chromosome": "14", "end_position": "105246551", "exon": "2", "feature_type": "somatic_variant", "gene": "AKT1", "protein_change": "p.E17K", "reference_allele": "C", "rsid": "rs34409589", "start_position": "105246551", "variant_annotation": "Missense" } ], "feature_id": 107, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Davies BR, Guan N, Logie A, et al. Tumors with AKT1 E17K Mutations Are Rational Targets for Single Agent or Combination Therapy with AKT Inhibitors. Mol Cancer Ther. 2015;14(11):2441-51.", "doi": "10.1158/1535-7163.MCT-15-0230", "nct": "", "pmid": 26351323, "source_id": 48, "source_type": "Journal", "url": "https://doi.org/10.1158/1535-7163.MCT-15-0230" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Akt Inhibitor MK2206", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 108, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Activating mutations in AKT may predict sensitivity to direct inhibition or downstream inhibition of the PI3K/mTOR pathway", "disease": "", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "AKT2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 108, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "", "predictive_implication": "Preclinical", "sources": [ { "citation": "Davies BR, Guan N, Logie A, et al. Tumors with AKT1E17K Mutations Are Rational Targets for Single Agent or Combination Therapy with AKT Inhibitors. Mol Cancer Ther. 2015;14(11):2441-51.", "doi": "10.1158/1535-7163.MCT-15-0230", "nct": "", "pmid": 26351323, "source_id": 49, "source_type": "Journal", "url": "https://doi.org/10.1158/1535-7163.MCT-15-0230" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Akt Inhibitor MK2206", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 109, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Activating mutations in AKT may predict sensitivity to direct inhibition or downstream inhibition of the PI3K/mTOR pathway", "disease": "", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "AKT3", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 109, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "", "predictive_implication": "Preclinical", "sources": [ { "citation": "Davies BR, Guan N, Logie A, et al. Tumors with AKT1E17K Mutations Are Rational Targets for Single Agent or Combination Therapy with AKT Inhibitors. Mol Cancer Ther. 2015;14(11):2441-51.", "doi": "10.1158/1535-7163.MCT-15-0230", "nct": "", "pmid": 26351323, "source_id": 49, "source_type": "Journal", "url": "https://doi.org/10.1158/1535-7163.MCT-15-0230" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Akt Inhibitor MK2206", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 110, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Ceritinib (LDK378), an ALK TKI, was evaluated in the context of crizotinib resistant ALK rearrangement positive non-small cell lung cancers. It was found that Certinib potently overcame crizotinib-resistant mutations. In particular, L1196M, G1269A, I1171T, S1206Y but it was not able to overcome G1202R and F1174C.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.3604G>A", "chromosome": "2", "end_position": "29443613", "exon": "23", "feature_type": "somatic_variant", "gene": "ALK", "protein_change": "p.G1202R", "reference_allele": "C", "rsid": "rs1057519783", "start_position": "29443613", "variant_annotation": "Missense" } ], "feature_id": 110, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Preclinical", "sources": [ { "citation": "Friboulet L, Li N, Katayama R, et al. The ALK inhibitor ceritinib overcomes crizotinib resistance in non-small cell lung cancer. Cancer Discov. 2014;4(6):662-673.", "doi": "10.1158/2159-8290.CD-13-0846", "nct": "", "pmid": 24675041, "source_id": 50, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-13-0846" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ceritinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "ALK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 111, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Ceritinib (LDK378), an ALK TKI, was evaluated in the context of crizotinib resistant ALK rearrangement positive non-small cell lung cancers. It was found that Certinib potently overcame crizotinib-resistant mutations. In particular, L1196M, G1269A, I1171T, S1206Y but it was not able to overcome G1202R and F1174C.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.3521T>G", "chromosome": "2", "end_position": "29443696", "exon": "23", "feature_type": "somatic_variant", "gene": "ALK", "protein_change": "p.F1174C", "reference_allele": "A", "rsid": "rs1057519697", "start_position": "29443696", "variant_annotation": "Missense" } ], "feature_id": 111, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Preclinical", "sources": [ { "citation": "Friboulet L, Li N, Katayama R, et al. The ALK inhibitor ceritinib overcomes crizotinib resistance in non-small cell lung cancer. Cancer Discov. 2014;4(6):662-673.", "doi": "10.1158/2159-8290.CD-13-0846", "nct": "", "pmid": 24675041, "source_id": 50, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-13-0846" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ceritinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "ALK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 112, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Ceritinib (LDK378), an ALK TKI, was evaluated in the context of crizotinib resistant ALK rearrangement positive non-small cell lung cancers. It was found that Certinib potently overcame crizotinib-resistant mutations. In particular, L1196M, G1269A, I1171T, S1206Y but it was not able to overcome G1202R and F1174C.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.3586C>A", "chromosome": "2", "end_position": "29443631", "exon": "23", "feature_type": "somatic_variant", "gene": "ALK", "protein_change": "p.L1196M", "reference_allele": "G", "rsid": "rs1057519784", "start_position": "29443631", "variant_annotation": "Missense" } ], "feature_id": 112, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Preclinical", "sources": [ { "citation": "Friboulet L, Li N, Katayama R, et al. The ALK inhibitor ceritinib overcomes crizotinib resistance in non-small cell lung cancer. Cancer Discov. 2014;4(6):662-673.", "doi": "10.1158/2159-8290.CD-13-0846", "nct": "", "pmid": 24675041, "source_id": 50, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-13-0846" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ceritinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ALK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 113, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Ceritinib (LDK378), an ALK TKI, was evaluated in the context of crizotinib resistant ALK rearrangement positive non-small cell lung cancers. It was found that Certinib potently overcame crizotinib-resistant mutations. In particular, L1196M, G1269A, I1171T, S1206Y but it was not able to overcome G1202R and F1174C.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.3806G>C", "chromosome": "2", "end_position": "29432682", "exon": "25", "feature_type": "somatic_variant", "gene": "ALK", "protein_change": "p.G1269A", "reference_allele": "C", "rsid": "rs1057519781", "start_position": "29432682", "variant_annotation": "Missense" } ], "feature_id": 113, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Preclinical", "sources": [ { "citation": "Friboulet L, Li N, Katayama R, et al. The ALK inhibitor ceritinib overcomes crizotinib resistance in non-small cell lung cancer. Cancer Discov. 2014;4(6):662-673.", "doi": "10.1158/2159-8290.CD-13-0846", "nct": "", "pmid": 24675041, "source_id": 50, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-13-0846" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ceritinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ALK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 114, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Ceritinib (LDK378), an ALK TKI, was evaluated in the context of crizotinib resistant ALK rearrangement positive non-small cell lung cancers. It was found that Certinib potently overcame crizotinib-resistant mutations. In particular, L1196M, G1269A, I1171T, S1206Y but it was not able to overcome G1202R and F1174C.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.3617C>A", "chromosome": "2", "end_position": "29443600", "exon": "23", "feature_type": "somatic_variant", "gene": "ALK", "protein_change": "p.S1206Y", "reference_allele": "G", "rsid": "rs1057519782", "start_position": "29443600", "variant_annotation": "Missense" } ], "feature_id": 114, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Preclinical", "sources": [ { "citation": "Friboulet L, Li N, Katayama R, et al. The ALK inhibitor ceritinib overcomes crizotinib resistance in non-small cell lung cancer. Cancer Discov. 2014;4(6):662-673.", "doi": "10.1158/2159-8290.CD-13-0846", "nct": "", "pmid": 24675041, "source_id": 50, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-13-0846" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ceritinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ALK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 115, "context": "Castration Resistant Prostate Cancer", "created_on": "05/07/26", "deprecated": false, "description": "Androgen receptor mutation may predict resistance to second generation androgen deprivation or direct androgen inhibitors.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2632A>G", "chromosome": "X", "end_position": "66943552", "exon": "8", "feature_type": "somatic_variant", "gene": "AR", "protein_change": "p.T878A", "reference_allele": "A", "rsid": "rs137852578", "start_position": "66943552", "variant_annotation": "Missense" } ], "feature_id": 115, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Chen EJ, Sowalsky AG, Gao S, et al. Abiraterone treatment in castration-resistant prostate cancer selects for progesterone responsive mutant androgen receptors. Clin Cancer Res. 2015;21(6):1273-80.", "doi": "10.1158/1078-0432.CCR-14-1220", "nct": "", "pmid": 25320358, "source_id": 51, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-14-1220" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Antiandrogen", "therapy_type": "Hormone therapy", "validated": true }, { "assertion_id": 116, "context": "Castration Resistant Prostate Cancer", "created_on": "05/07/26", "deprecated": false, "description": "Androgen receptor mutation may predict resistance to second generation androgen deprivation or direct androgen inhibitors.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.2105T>A", "chromosome": "X", "end_position": "66931463", "exon": "4", "feature_type": "somatic_variant", "gene": "AR", "protein_change": "p.L702H", "reference_allele": "T", "rsid": null, "start_position": "66931463", "variant_annotation": "Missense" } ], "feature_id": 116, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Chen EJ, Sowalsky AG, Gao S, et al. Abiraterone treatment in castration-resistant prostate cancer selects for progesterone responsive mutant androgen receptors. Clin Cancer Res. 2015;21(6):1273-80.", "doi": "10.1158/1078-0432.CCR-14-1220", "nct": "", "pmid": 25320358, "source_id": 51, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-14-1220" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Antiandrogen", "therapy_type": "Hormone therapy", "validated": true }, { "assertion_id": 117, "context": "Advanced", "created_on": "05/07/26", "deprecated": false, "description": "Activating mutations in ARAF may predict sensitivity to sorafenib or other RAF inhibitors. Patient received 5 year response to sorafenib with ARAF S214C.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.641C>G", "chromosome": "X", "end_position": "47426121", "exon": "7", "feature_type": "somatic_variant", "gene": "ARAF", "protein_change": "p.S214C", "reference_allele": "C", "rsid": null, "start_position": "47426121", "variant_annotation": "Missense" } ], "feature_id": 117, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Imielinski M, Greulich H, Kaplan B, et al. Oncogenic and sorafenib-sensitive ARAF mutations in lung adenocarcinoma. J Clin Invest. 2014;124(4):1582-6.", "doi": "10.1172/JCI72763", "nct": "", "pmid": 24569458, "source_id": 52, "source_type": "Journal", "url": "https://doi.org/10.1172/JCI72763" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Sorafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 118, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function ARID1A mutations may predict sensitivity to immune checkpoint blockade, particularly PD-L1 inhibition. Anti-PD-L1 antibody reduced tumor mutational burden and prolonged survival of mice ARID1A-deficient but not ARID1A-wild-type ovarian tumors.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ARID1A", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 118, "feature_type": "somatic_variant" } ], "last_updated": "2019-02-04", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Preclinical", "sources": [ { "citation": "Shen J, Ju Z, Zhao W, et al. ARID1A deficiency promotes mutability and potentiates therapeutic antitumor immunity unleashed by immune checkpoint blockade. Nat Med. 2018;24(5):556-562.", "doi": "10.1038/s41591-018-0012-z", "nct": "", "pmid": 29736026, "source_id": 53, "source_type": "Journal", "url": "https://doi.org/10.1038/s41591-018-0012-z" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Durvalumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 119, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function ARID1A mutations may predict sensitivity to immune checkpoint blockade, particularly PD-L1 inhibition. Anti-PD-L1 antibody reduced tumor mutational burden and prolonged survival of mice ARID1A-deficient but not ARID1A-wild-type ovarian tumors.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ARID1A", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 119, "feature_type": "somatic_variant" } ], "last_updated": "2019-02-04", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Preclinical", "sources": [ { "citation": "Shen J, Ju Z, Zhao W, et al. ARID1A deficiency promotes mutability and potentiates therapeutic antitumor immunity unleashed by immune checkpoint blockade. Nat Med. 2018;24(5):556-562.", "doi": "10.1038/s41591-018-0012-z", "nct": "", "pmid": 29736026, "source_id": 53, "source_type": "Journal", "url": "https://doi.org/10.1038/s41591-018-0012-z" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Durvalumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 120, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "ARID1A mutations were associated with poorer prognosis in a study of 109 microdissected pancreatic adenocarcinoma tumors.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ARID1A", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 120, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Witkiewicz AK, Mcmillan EA, Balaji U, et al. Whole-exome sequencing of pancreatic cancer defines genetic diversity and therapeutic targets. Nat Commun. 2015;6:6744.", "doi": "10.1038/ncomms7744", "nct": "", "pmid": 25855536, "source_id": 54, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms7744" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 121, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights ASXL1 frameshift and nonsense variants as associated with poor prognosis in myelodysplastic syndromes, and is mutated most frequently in chronic myelomonocytic leukemia (CMML).", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ASXL1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 121, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 122, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights ASXL1 frameshift and nonsense variants as associated with poor prognosis in myelodysplastic syndromes, and is mutated most frequently in chronic myelomonocytic leukemia (CMML).", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ASXL1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 122, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 123, "context": "Advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The ATR inhibitor BAY 1895344 was tolerated in a dose-escalation phase 1 trial (NCT03188965) across 21 patients with advanced solid tumors. Responders had ATM protein loss and/or deleterious ATM variants.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ATM", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 123, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Yap TA, Tan DSP, Terbuch A, et al. First-in-Human Trial of the Oral Ataxia Telangiectasia and RAD3-Related (ATR) Inhibitor BAY 1895344 in Patients with Advanced Solid Tumors. Cancer Discovery. 2021;11(1):80-91.", "doi": "10.1158/2159-8290.CD-20-0868", "nct": "", "pmid": 32988960, "source_id": 55, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-20-0868" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Elimusertib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ATR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 124, "context": "Advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The ATR inhibitor BAY 1895344 was tolerated in a dose-escalation phase 1 trial (NCT03188965) across 21 patients with advanced solid tumors. Responders had ATM protein loss and/or deleterious ATM variants.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ATM", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 124, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Yap TA, Tan DSP, Terbuch A, et al. First-in-Human Trial of the Oral Ataxia Telangiectasia and RAD3-Related (ATR) Inhibitor BAY 1895344 in Patients with Advanced Solid Tumors. Cancer Discovery. 2021;11(1):80-91.", "doi": "10.1158/2159-8290.CD-20-0868", "nct": "", "pmid": 32988960, "source_id": 55, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-20-0868" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Elimusertib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ATR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 125, "context": "Advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The ATR inhibitor BAY 1895344 was tolerated in a dose-escalation phase 1 trial (NCT03188965) across 21 patients with advanced solid tumors. Responders had ATM protein loss and/or deleterious ATM variants.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ATM", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 125, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Yap TA, Tan DSP, Terbuch A, et al. First-in-Human Trial of the Oral Ataxia Telangiectasia and RAD3-Related (ATR) Inhibitor BAY 1895344 in Patients with Advanced Solid Tumors. Cancer Discovery. 2021;11(1):80-91.", "doi": "10.1158/2159-8290.CD-20-0868", "nct": "", "pmid": 32988960, "source_id": 55, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-20-0868" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Elimusertib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ATR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 126, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In a retrospective review of 8 patients with somatic truncating ATM mutations receiving palliative radiation therapy, excellent responses were seen with a median local control period of 4.62 years.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ATM", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 126, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Ma J, Setton J, Morris L, et al. Genomic analysis of exceptional responders to radiotherapy reveals somatic mutations in ATM Oncotarget. 2016; 8(6).", "doi": "10.18632/oncotarget.14400", "nct": "", "pmid": 28055970, "source_id": 56, "source_type": "Journal", "url": "https://doi.org/10.18632/oncotarget.14400" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Radiation Therapy", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 127, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In a retrospective review of 8 patients with somatic truncating ATM mutations receiving palliative radiation therapy, excellent responses were seen with a median local control period of 4.62 years.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ATM", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 127, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Ma J, Setton J, Morris L, et al. Genomic analysis of exceptional responders to radiotherapy reveals somatic mutations in ATM Oncotarget. 2016; 8(6).", "doi": "10.18632/oncotarget.14400", "nct": "", "pmid": 28055970, "source_id": 56, "source_type": "Journal", "url": "https://doi.org/10.18632/oncotarget.14400" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Radiation Therapy", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 128, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In a retrospective review of 8 patients with somatic truncating ATM mutations receiving palliative radiation therapy, excellent responses were seen with a median local control period of 4.62 years.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ATM", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 128, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Ma J, Setton J, Morris L, et al. Genomic analysis of exceptional responders to radiotherapy reveals somatic mutations in ATM Oncotarget. 2016; 8(6).", "doi": "10.18632/oncotarget.14400", "nct": "", "pmid": 28055970, "source_id": 56, "source_type": "Journal", "url": "https://doi.org/10.18632/oncotarget.14400" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Radiation Therapy", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 129, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "HCT116 colorectal cancer cell lines are heterozygous for c.3380C>A and sensitive to PARP inhibition following shRNA depletion of ATM. Deletion of p53 enhances sensitivity.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.3380C>A", "chromosome": "11", "end_position": "108150313", "exon": "23", "feature_type": "somatic_variant", "gene": "ATM", "protein_change": "p.A1127D", "reference_allele": "C", "rsid": "rs1555090340", "start_position": "108150313", "variant_annotation": "Missense" } ], "feature_id": 129, "feature_type": "somatic_variant" } ], "last_updated": "2019-08-15", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Wang C, Jette N, Moussienko D, Bebb DG, Lees-Miller SP. ATM-Deficient Colorectal Cancer Cells Are Sensitive to the PARP Inhibitor Olaparib Translational Oncology. 2017; 10(2):190-196.", "doi": "10.1016/j.tranon.2017.01.007", "nct": "", "pmid": 28182994, "source_id": 57, "source_type": "Journal", "url": "https://doi.org/10.1016/j.tranon.2017.01.007" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 130, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ATM", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 130, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 131, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BARD1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 131, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 132, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BARD1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 132, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 133, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BARD1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 133, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 134, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BARD1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 134, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 135, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BARD1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 135, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 136, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BARD1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 136, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 137, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BARD1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 137, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 138, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights BCOR frameshift, splice site, and nonsense variants as associated with poor prognosis in myelodysplastic syndromes, and is mutated most frequently in chronic myelomonocytic leukemia (CMML).", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BCOR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 138, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 139, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights BCOR frameshift, splice site, and nonsense variants as associated with poor prognosis in myelodysplastic syndromes, and is mutated most frequently in chronic myelomonocytic leukemia (CMML).", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BCOR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 139, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 140, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights BCOR frameshift, splice site, and nonsense variants as associated with poor prognosis in myelodysplastic syndromes, and is mutated most frequently in chronic myelomonocytic leukemia (CMML).", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BCOR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 140, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 141, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "More frequent in Chronic Myelomonocytic Leukemia.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.4376A>G", "chromosome": "X", "end_position": "39921444", "exon": "10", "feature_type": "somatic_variant", "gene": "BCOR", "protein_change": "p.N1425S", "reference_allele": "T", "rsid": null, "start_position": "39921444", "variant_annotation": "Missense" } ], "feature_id": 141, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 142, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BCR-ABL may suggest resistance to imatinib in CML.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BCR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 142, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Soverini S, Hochhaus A, Nicolini FE, Gruber F, Lange T, Saglio G, et al. (2011) Bcr-Abl kinase domain mutation analysis in chronic myeloid leukemia patients treated with tyrosine kinase inihibitors: recommendations from an expert panel on behalf of European LeukemiaNet. Blood: blood-2010-2012-326405", "doi": "10.1182/blood-2010-12-326405", "nct": "", "pmid": 27760149, "source_id": 46, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2010-12-326405" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 143, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "BLM may indicate a predisposition for early onset of colorectal cancer, although with a low-moderate penetrance.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BLM", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 143, "feature_type": "somatic_variant" } ], "last_updated": "2019-04-30", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "De voer RM, Hahn MM, Mensenkamp AR, et al. Deleterious Germline BLM Mutations and the Risk for Early-onset Colorectal Cancer. Sci Rep. 2015;5:14060.", "doi": "10.1038/srep14060", "nct": "", "pmid": 26358404, "source_id": 61, "source_type": "Journal", "url": "https://doi.org/10.1038/srep14060" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 144, "context": "Unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to dabrafenib as a single agent for the treament of patients with unresectable or metastatic melanoma (MEL) with BRAF V600E mutation, as detected by an FDA-approved test.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 144, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Tafinlar (dabrafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202806s015lbl.pdf. Revised April 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 62, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202806s015lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dabrafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 145, "context": "Unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to dabrafenib in combination with trametinib for the treament of patients with unresectable or metastatic melanoma (MEL) with BRAF V600E or V600K mutation, as detected by an FDA-approved test.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 145, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Tafinlar (dabrafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202806s015lbl.pdf. Revised April 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 62, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202806s015lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dabrafenib + Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition + MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 146, "context": "Unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to dabrafenib in combination with trametinib for the treament of patients with unresectable or metastatic melanoma (MEL) with BRAF V600E or V600K mutation, as detected by an FDA-approved test.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "TT", "cdna_change": "c.1798_1799GT>AA", "chromosome": "7", "end_position": "140453137", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600K", "reference_allele": "AC", "rsid": "rs121913227", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 146, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Tafinlar (dabrafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202806s015lbl.pdf. Revised April 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 62, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202806s015lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dabrafenib + Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition + MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 147, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to dabrafenib in combination with trametinib for the adjuvant treament of patients with unresectable or metastatic melanoma (MEL) with BRAF V600E or V600K mutation, as detected by an FDA-approved test, and involvement of lymph node(s), following complete resection.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 147, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Tafinlar (dabrafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202806s015lbl.pdf. Revised April 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 62, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202806s015lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dabrafenib + Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition + MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 148, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to dabrafenib in combination with trametinib for the adjuvant treament of patients with unresectable or metastatic melanoma (MEL) with BRAF V600E or V600K mutation, as detected by an FDA-approved test, and involvement of lymph node(s), following complete resection.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "TT", "cdna_change": "c.1798_1799GT>AA", "chromosome": "7", "end_position": "140453137", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600K", "reference_allele": "AC", "rsid": "rs121913227", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 148, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Tafinlar (dabrafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202806s015lbl.pdf. Revised April 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 62, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202806s015lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dabrafenib + Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition + MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 149, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to dabrafenib in combination with trametinib for the treament of patients with metastatic non-small cell lung cancer (NSCLC) with BRAF V600E, as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 149, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Tafinlar (dabrafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202806s015lbl.pdf. Revised April 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 62, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202806s015lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dabrafenib + Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition + MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 150, "context": "Unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to trametinib as a single agent for the treament of patients with unresectable or metastatic melanoma (MEL) with BRAF V600E or V600K mutation, as detected by an FDA-approved test.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 150, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Mekinist (trametinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/204114s016lbl.pdf. Revised June 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 63, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/204114s016lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 151, "context": "Unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to trametinib as a single agent for the treament of patients with unresectable or metastatic melanoma (MEL) with BRAF V600E or V600K mutation, as detected by an FDA-approved test.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "TT", "cdna_change": "c.1798_1799GT>AA", "chromosome": "7", "end_position": "140453137", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600K", "reference_allele": "AC", "rsid": "rs121913227", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 151, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Mekinist (trametinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/204114s016lbl.pdf. Revised June 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 63, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/204114s016lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 152, "context": "Unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted regular approval to encorafenib for the treatment of patients with unresectable or metastatic melanoma (MEL) with BRAF V600K mutation, as detected by an FDA-approved test.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "TT", "cdna_change": "c.1798_1799GT>AA", "chromosome": "7", "end_position": "140453137", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600K", "reference_allele": "AC", "rsid": "rs121913227", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 152, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-16", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Array BioPharma Inc. Braftovi (encorafenib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/210496s006lbl.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 64, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/210496s006lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Encorafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 153, "context": "Unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted regular approval to encorafenib for the treatment of patients with unresectable or metastatic melanoma (MEL) with BRAF V600E mutation, as detected by an FDA-approved test.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 153, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-16", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Array BioPharma Inc. Braftovi (encorafenib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/210496s006lbl.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 64, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/210496s006lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Encorafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 154, "context": "Metastatic, after prior therapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted regular approval to encorafenib in combination with cetuximab for the treatment of adult patients with metastatic colorectal cancer (CRC) with BRAF V600E mutation, as detected by an FDA-approved test, after prior therapy.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 154, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Array BioPharma Inc. Braftovi (encorafenib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/210496s006lbl.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 64, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/210496s006lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cetuximab + Encorafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition + B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 155, "context": "Unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted regular approval to vemurafenib for the treatment of patients with unresectable or metastatic melanoma (MEL) with BRAF V600E mutation, as detected by an FDA-approved test.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 155, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Zelboraf (vemurafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202429s019lbl.pdf. Revised May 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 65, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202429s019lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 156, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Panitumumab (Vectibix) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with metastatic colorectal cancer, BRAF V600E makes response to panitumumab or cetuximab highly unlikely unless given with a BRAF inhibitor. ", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 156, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.4.2018. \u00a9 National Comprehensive Cancer Network, Inc. 2018. All rights reserved. Accessed March 20 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 66, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Panitumumab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 157, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "BRAF V600E alterations are associated with an unfavorable prognosis in MSI-low and microsatellite-stable patients.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 157, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed March 20 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 67, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 158, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Vemurafenib (Zelboraf) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with BRAF p.V600E mutant melanoma. Activating BRAF mutations are associated with an increased sensitivity to BRAF inhibitors. Co-administration with a MEK inhibitor may potentiate the effects of BRAF inhibitors.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 158, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Melanoma V.3.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 68, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 159, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Dabrafenib (Tafinlar) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with BRAF p.V600E mutant melanoma. Activating BRAF mutations are associated with an increased sensitivity to BRAF inhibitors. Co-administration with a MEK inhibitor may potentiate the effects of BRAF inhibitors.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 159, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Melanoma V.3.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 68, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dabrafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 160, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Vemurafenib (Zelboraf) in combination with Cobimetinib (Coltellic) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with BRAF p.V600E mutant melanoma. Activating BRAF mutations are associated with an increased sensitivity to BRAF inhibitors. Co-administration with a MEK inhibitor may potentiate the effects of BRAF inhibitors.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 160, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Melanoma V.3.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 68, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cobimetinib + Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition + B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 161, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Dabrafenib (Tafinlar) in combination with Trametinib (Mekinist) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with BRAF p.V600E mutant melanoma. Activating BRAF mutations are associated with an increased sensitivity to BRAF inhibitors. Co-administration with a MEK inhibitor may potentiate the effects of BRAF inhibitors.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 161, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Melanoma V.3.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 68, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dabrafenib + Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition + MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 162, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The combination of ipilimumab and vemurafenib in a sequencing strategy showed limited efficacy in a phase II study.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 162, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Amin A, Lawson DH, Salama AK, et al. Phase II study of vemurafenib followed by ipilimumab in patients with previously untreated BRAF-mutated metastatic melanoma. J Immunother Cancer. 2016;4:44.", "doi": "10.1186/s40425-016-0148-7", "nct": "NCT01673854", "pmid": 27532019, "source_id": 69, "source_type": "Journal", "url": "https://doi.org/10.1186/s40425-016-0148-7" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ipilimumab + Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CTLA-4 inhibition + B-RAF inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 163, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The combination of ipilimumab and vemurafenib in a sequencing strategy showed limited efficacy in a phase II study.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 163, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Amin A, Lawson DH, Salama AK, et al. Phase II study of vemurafenib followed by ipilimumab in patients with previously untreated BRAF-mutated metastatic melanoma. J Immunother Cancer. 2016;4:44.", "doi": "10.1186/s40425-016-0148-7", "nct": "NCT01673854", "pmid": 27532019, "source_id": 69, "source_type": "Journal", "url": "https://doi.org/10.1186/s40425-016-0148-7" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ipilimumab + Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CTLA-4 inhibition + B-RAF inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 164, "context": "Resistance to BRAFi monotherapy", "created_on": "05/07/26", "deprecated": false, "description": "Administration of bevacizumab in a dabrafenib-resistant melanoma cancer cell line (A375R) counteracted the tumor growth stimulating effect of administering dabrafenib post-resistance. This study suggests that a regime which combines BRAFi with bevacizumab or inhibitors of PI3K/Akt/mTOR may be more effective than BRAFi monotherapy in the setting of resistance.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 164, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Caporali S, Alvino E, Lacal PM, et al. Targeting the PI3K/AKT/mTOR pathway overcomes the stimulating effect of dabrafenib on the invasive behavior of melanoma cells with acquired resistance to the BRAF inhibitor. Int J Oncol. 2016;49(3):1164-74.", "doi": "10.3892/ijo.2016.3594", "nct": "", "pmid": 27572607, "source_id": 70, "source_type": "Journal", "url": "https://doi.org/10.3892/ijo.2016.3594" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bevacizumab + Dabrafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition + VEGF/VEGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 165, "context": "Resistance to BRAFi monotherapy", "created_on": "05/07/26", "deprecated": false, "description": "Administration of GSK2126458A, a PI3K/AKT/mTOR pathway inhibitor, in a dabrafenib-resistant cell line counteracted the tumor growth stimulating effect of administering dabrafenib post-resistance. This study suggests that a regime which combines BRAFi with bevacizumab or inhibitors of PI3K/Akt/mTOR may be more effective than BRAFi monotherapy in the setting of resistance.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 165, "feature_type": "somatic_variant" } ], "last_updated": "2023-10-31", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Caporali S, Alvino E, Lacal PM, et al. Targeting the PI3K/AKT/mTOR pathway overcomes the stimulating effect of dabrafenib on the invasive behavior of melanoma cells with acquired resistance to the BRAF inhibitor. Int J Oncol. 2016;49(3):1164-74.", "doi": "10.3892/ijo.2016.3594", "nct": "", "pmid": 27572607, "source_id": 70, "source_type": "Journal", "url": "https://doi.org/10.3892/ijo.2016.3594" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dabrafenib + Omipalisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition + PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 166, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Treating mutant BRAF melanoma cell with both Selumetinib and PLX4720, a predecessor to Vemurafenib, prevented emergence of resistant clones.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 166, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Emery CM, Vijayendran KG, Zipser MC, et al. MEK1 mutations confer resistance to MEK and B-RAF inhibition. Proc Natl Acad Sci USA. 2009;106(48):20411-6.", "doi": "10.1073/pnas.0905833106", "nct": "", "pmid": 19915144, "source_id": 71, "source_type": "Journal", "url": "https://doi.org/10.1073/pnas.0905833106" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib + Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition + B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 167, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Three human melanoma cell lines displayed sensitivity to bleomycin, particularly when co-administered with human interferon-beta gene or herpes simplex virus thymidine kinase/ganciclovir suicide gene lipofection.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 167, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Fondello C, Agnetti L, Villaverde MS, Simian M, Glikin GC, Finocchiaro LM. The combination of bleomycin with suicide or interferon-beta gene transfer is able to efficiently eliminate human melanoma tumor initiating cells. Biomed Pharmacother. 2016;83:290-301.", "doi": "10.1016/j.biopha.2016.06.038", "nct": "", "pmid": 27399807, "source_id": 72, "source_type": "Journal", "url": "https://doi.org/10.1016/j.biopha.2016.06.038" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bleomycin", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Intercalated chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 168, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mitochondria-targeted metabolism-interferring agent mito-CP (mitochondria-targeted carboxy-proxyl) demonstrated a tumor-suppressing effect in BRAF V600E-mutated melanoma mouse models, including models that had developed resistance to vemurafenib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 168, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Hong SK, Starenki D, Wu PK, Park JI. Suppression of B-Raf(V600E) melanoma cell survival by targeting mitochondria using triphenyl-phosphonium-conjugated nitroxide or ubiquinone. Cancer Biol Ther. 2016;", "doi": "10.1080/15384047.2016.1250987", "nct": "", "pmid": 27786591, "source_id": 73, "source_type": "Journal", "url": "https://doi.org/10.1080/15384047.2016.1250987" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Mito-CP", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Metabolism interference", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 169, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Activating BRAF mutations are associated with an increased sensitivity to BRAF inhibitors. Co-administration with a MEK inhibitor may potentiate the effects of BRAF inhibitors.", "disease": "Langerhans Cell Histiocytosis", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 169, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "LCH", "oncotree_term": "Langerhans Cell Histiocytosis", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Hyman DM, Puzanov I, Subbiah V, et al. Vemurafenib in Multiple Nonmelanoma Cancers with BRAF V600 Mutations. N Engl J Med. 2015;373(8):726-36.", "doi": "10.1056/NEJMoa1502309", "nct": "NCT01524978", "pmid": 26287849, "source_id": 74, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1502309" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 170, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Activating BRAF mutations are associated with an increased sensitivity to BRAF inhibitors. Co-administration with a MEK inhibitor may potentiate the effects of BRAF inhibitors.", "disease": "Non-Langerhans Cell Histiocytosis/Erdheim-Chester Disease", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 170, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "ECD", "oncotree_term": "Non-Langerhans Cell Histiocytosis/Erdheim-Chester Disease", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Hyman DM, Puzanov I, Subbiah V, et al. Vemurafenib in Multiple Nonmelanoma Cancers with BRAF V600 Mutations. N Engl J Med. 2015;373(8):726-36.", "doi": "10.1056/NEJMoa1502309", "nct": "NCT01524978", "pmid": 26287849, "source_id": 74, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1502309" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 171, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Activating BRAF mutations are associated with an increased sensitivity to BRAF inhibitors. Co-administration with a MEK inhibitor may potentiate the effects of BRAF inhibitors.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 171, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Hyman DM, Puzanov I, Subbiah V, et al. Vemurafenib in Multiple Nonmelanoma Cancers with BRAF V600 Mutations. N Engl J Med. 2015;373(8):726-36.", "doi": "10.1056/NEJMoa1502309", "nct": "NCT01524978", "pmid": 26287849, "source_id": 74, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1502309" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 172, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Study of a patient-derived orthotopic xenograft (PDOX) model suggests some vemurafenib-resistant BRAF-V600E-mutated melanomas may be sensitive to trametinib (but not cobimetinib) treatment.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 172, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Kawaguchi K, Murakami T, Chmielowski B, et al. Vemurafenib-resistant BRAF-V600E-mutated melanoma is regressed by MEK-targeting drug trametinib, but not cobimetinib in a patient-derived orthotopic xenograft (PDOX) mouse model. Oncotarget. 2016;", "doi": "10.18632/oncotarget.12328", "nct": "", "pmid": 27690220, "source_id": 75, "source_type": "Journal", "url": "https://doi.org/10.18632/oncotarget.12328" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 173, "context": "Poorly differentiatied high-grade", "created_on": "05/07/26", "deprecated": false, "description": "Two patients with metastatic colorectal neuroendocrine tumors refractory to treatment exhibited a durable response to combined BRAF-MEK inhibition. One patient with BRAF V600E observed ongoing response lasting over 7 months when treated with dabrafenib and trametinib in combination.", "disease": "High-Grade Neuroendocrine Carcinoma of the Colon and Rectum", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 173, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "HGNEC", "oncotree_term": "High-Grade Neuroendocrine Carcinoma of the Colon and Rectum", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Klempner SJ, Gershenhorn B, Tran P, et al. BRAFV600E Mutations in High-Grade Colorectal Neuroendocrine Tumors May Predict Responsiveness to BRAF-MEK Combination Therapy. Cancer Discov. 2016;6(6):594-600.", "doi": "10.1158/2159-8290.CD-15-1192", "nct": "", "pmid": 27048246, "source_id": 76, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-15-1192" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dabrafenib + Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition + MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 174, "context": "Locally advanced high-grade", "created_on": "05/07/26", "deprecated": false, "description": "Two patients with metastatic colorectal neuroendocrine tumors refractory to treatment exhibited a durable response to combined BRAF-MEK inhibition. One patient with BRAF V600E observed ongoing response lasting 9 months when treated with vemurafenib and trametinib in combination.", "disease": "High-Grade Neuroendocrine Carcinoma of the Colon and Rectum", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 174, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "HGNEC", "oncotree_term": "High-Grade Neuroendocrine Carcinoma of the Colon and Rectum", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Klempner SJ, Gershenhorn B, Tran P, et al. BRAFV600E Mutations in High-Grade Colorectal Neuroendocrine Tumors May Predict Responsiveness to BRAF-MEK Combination Therapy. Cancer Discov. 2016;6(6):594-600.", "doi": "10.1158/2159-8290.CD-15-1192", "nct": "", "pmid": 27048246, "source_id": 76, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-15-1192" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Trametinib + Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition + B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 175, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Preclinical evidence suggests the combination of proteasome inhibitor ixazomib with interferon-alpha may negatively impact tumor cell viability in melanoma, particularly in patients with BRAF V600E mutations.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 175, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Suarez-kelly LP, Kemper GM, Duggan MC, et al. The combination of MLN2238 (ixazomib) with interferon-alpha results in enhanced cell death in melanoma. Oncotarget. 2016;", "doi": "10.18632/oncotarget.12791", "nct": "", "pmid": 27783987, "source_id": 77, "source_type": "Journal", "url": "https://doi.org/10.18632/oncotarget.12791" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Interferon Alpha + Ixazomib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Interferon-alpha + Proteasome inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 176, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Targeted agents, such as dabrafenib, that inhibit effector kinases of the mitogen-activated protein kinase (MAPK) signaling cascade, including BRAF, have improved progression-free survival and overall survival when used as a monotherapy in BRAF-mutant melanoma.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 176, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wagle, Nikhil, et al. MAP kinase pathway alterations in BRAF-mutant melanoma patients with acquired resistance to combined RAF/MEK inhibition. Cancer discovery 4.1 (2014): 61-68.", "doi": "10.1158/2159-8290.CD-13-0631", "nct": "", "pmid": 24265154, "source_id": 78, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-13-0631" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dabrafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 177, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Targeted agents, such as vemurafenib, that inhibit effector kinases of the mitogen-activated protein kinase (MAPK) signaling cascade, including BRAF, have improved progression-free survival and overall survival when used as a monotherapy in BRAF-mutant melanoma.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 177, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wagle, Nikhil, et al. MAP kinase pathway alterations in BRAF-mutant melanoma patients with acquired resistance to combined RAF/MEK inhibition. Cancer discovery 4.1 (2014): 61-68.", "doi": "10.1158/2159-8290.CD-13-0631", "nct": "", "pmid": 24265154, "source_id": 78, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-13-0631" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 178, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Combination therapy of dabrafenib and tremetinib improved progression-free survival, objective response, and duration of response relative to dabrafenib monotherapy in a phase I/II trial.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 178, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wagle, Nikhil, et al. MAP kinase pathway alterations in BRAF-mutant melanoma patients with acquired resistance to combined RAF/MEK inhibition. Cancer discovery 4.1 (2014): 61-68.", "doi": "10.1158/2159-8290.CD-13-0631", "nct": "", "pmid": 24265154, "source_id": 78, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-13-0631" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dabrafenib + Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition + MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 179, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Targeted agents, such as tremetinib, that inhibit effector kinases of the mitogen-activated protein kinase (MAPK) signaling cascade, including MEK1 and MEK2, have improved progression-free survival and overall survival when used as a monotherapy in BRAF-mutant melanoma.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 179, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wagle, Nikhil, et al. MAP kinase pathway alterations in BRAF-mutant melanoma patients with acquired resistance to combined RAF/MEK inhibition. Cancer discovery 4.1 (2014): 61-68.", "doi": "10.1158/2159-8290.CD-13-0631", "nct": "", "pmid": 24265154, "source_id": 78, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-13-0631" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 180, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "BRAF V600E mutations were associated with sensitivity to the BRAF inhibitor PLX-4032 in a study of 109 microdissected pancreatic ductal adenocarcinoma patients.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 180, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Witkiewicz AK, Mcmillan EA, Balaji U, et al. Whole-exome sequencing of pancreatic cancer defines genetic diversity and therapeutic targets. Nat Commun. 2015;6:6744.", "doi": "10.1038/ncomms7744", "nct": "", "pmid": 25855536, "source_id": 54, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms7744" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 181, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Vemurafenib monotherapy is efficacious in preclinical models of pediatric gliomas harboring BRAF V600E mutations, but resistance quickly develops. EGFR inhibition appears to rescue the effects of vemurafenib in these models.", "disease": "Glioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 181, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "GNOS", "oncotree_term": "Glioma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Yao TW, Zhang J, Prados M, Weiss WA, James CD, Nicolaides T. EGFR blockade prevents glioma escape from BRAFV600E targeted therapy. Oncotarget. 2015;6(26):21993-2005.", "doi": "10.18632/oncotarget.4014", "nct": "", "pmid": 26023796, "source_id": 79, "source_type": "Journal", "url": "https://doi.org/10.18632/oncotarget.4014" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Neratinib + Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition + B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 182, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Cetuximab (Erbitux) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with metastatic colorectal cancer, BRAF V600E makes response to panitumumab or cetuximab highly unlikely unless given with a BRAF inhibitor. ", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 182, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.4.2018. \u00a9 National Comprehensive Cancer Network, Inc. 2018. All rights reserved. Accessed March 20 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 66, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cetuximab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 183, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "BRAF V600E alterations are associated with an unfavorable prognosis in MSI-low and microsatellite-stable patients.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 183, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 80, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 184, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Vemurafenib alone had insufficient activity in BRAF V600E mutant colorectal cancer patients. Of patients who received vemurafenib and cetuximab, one response was observed; however, approximately half of the patients had tumor regression that did not meet the standard criteria of partial response.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 184, "feature_type": "somatic_variant" } ], "last_updated": "2019-10-04", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Hyman DM, Puzanov I, Subbiah V, et al. Vemurafenib in Multiple Nonmelanoma Cancers with BRAF V600 Mutations. N Engl J Med. 2015;373(8):726-36.", "doi": "10.1056/NEJMoa1502309", "nct": "NCT01524978", "pmid": 26287849, "source_id": 74, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1502309" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cetuximab + Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition + B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 185, "context": "Advanced", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for olaparib for the maintenance treatment of adult patients with deleterious or suspected deleterious germline or somatic BRCA-mutated advanced epithelial ovarian, fallopian tube or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy.", "disease": "Ovarian Epithelial Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 185, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "OVT", "oncotree_term": "Ovarian Epithelial Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12, 2020.", "doi": "", "nct": "NCT01844986", "pmid": "", "source_id": 81, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 186, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for approved olaparib for the maintenance treatment of adult patients with deleterious or suspected deleterious germline or somatic BRCA-mutated advanced epithelial ovarian, fallopian tube or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy.", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 186, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12, 2020.", "doi": "", "nct": "NCT01844986", "pmid": "", "source_id": 81, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 187, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for approved olaparib for the maintenance treatment of adult patients with deleterious or suspected deleterious germline or somatic BRCA-mutated advanced epithelial ovarian, fallopian tube or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy.", "disease": "Peritoneal Serous Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 187, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "PSEC", "oncotree_term": "Peritoneal Serous Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12, 2020.", "doi": "", "nct": "NCT01844986", "pmid": "", "source_id": 81, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 188, "context": "Previously treated with 2 or more chemotherapies", "created_on": "05/07/26", "deprecated": false, "description": "Rucaparib is indicated as monotherapy for the treatment of epithelial ovarian, fallopian tube, or primary peritoneal cancer with deleterious BRCA mutation (germline and/or somatic) as detected by a US FDA-approved test (available at http://www.fda.gov/CompanionDiagnostics) in patients who have been previously treated with 2 or more chemotherapies", "disease": "Ovarian Epithelial Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 188, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "OVT", "oncotree_term": "Ovarian Epithelial Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Clovis Oncology, Inc. Rucaparib (rucaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/209115s008lbl.pdf. Revised October 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 82, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/209115s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Rucaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 189, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Rucaparib is indicated as monotherapy for the treatment of epithelial ovarian, fallopian tube, or primary peritoneal cancer with deleterious BRCA mutation (germline and/or somatic) as detected by a US FDA-approved test (available at http://www.fda.gov/CompanionDiagnostics) in patients who have been previously treated with 2 or more chemotherapies", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 189, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Clovis Oncology, Inc. Rucaparib (rucaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/209115s008lbl.pdf. Revised October 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 82, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/209115s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Rucaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 190, "context": "Previously treated with 2 or more chemotherapies", "created_on": "05/07/26", "deprecated": false, "description": "Rucaparib is indicated as monotherapy for the treatment of epithelial ovarian, fallopian tube, or primary peritoneal cancer with deleterious BRCA mutation (germline and/or somatic) as detected by a US FDA-approved test (available at http://www.fda.gov/CompanionDiagnostics) in patients who have been previously treated with 2 or more chemotherapies", "disease": "Peritoneal Serous Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 190, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "PSEC", "oncotree_term": "Peritoneal Serous Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Clovis Oncology, Inc. Rucaparib (rucaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/209115s008lbl.pdf. Revised October 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 82, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/209115s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Rucaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 191, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutations in BRCA1 or BRCA2 may predict sensitivity to PARP inhibition in ovarian cancer", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 191, "feature_type": "somatic_variant" } ], "last_updated": "2019-03-20", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Fong PC, Yap TA, Boss DS, et al. Poly(ADP)-ribose polymerase inhibition: frequent durable responses in BRCA carrier ovarian cancer correlating with platinum-free interval. J Clin Oncol. 2010;28(15):2512-9.", "doi": "10.1200/JCO.2009.26.9589", "nct": "", "pmid": 20406929, "source_id": 83, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2009.26.9589" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 192, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BRCA1 may confer resistance to PARP inhibition in ovarian cancer", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 192, "feature_type": "somatic_variant" } ], "last_updated": "2019-03-20", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Lheureux S, Bruce JP, Burnier JV, et al. Somatic BRCA1/2 Recovery as a Resistance Mechanism After Exceptional Response to Poly (ADP-ribose) Polymerase Inhibition. J Clin Oncol. 2017;:JCO2016713677.", "doi": "10.1200/JCO.2016.71.3677", "nct": "", "pmid": 28221868, "source_id": 84, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2016.71.3677" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 193, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "When present alongside genomic instability, defined by a large number of structural variation events, the inactivation of DNA maintenance genes (BRCA1, BRCA2, PALB2) was associated with increased sensitivity to platinum therapy in pancreatic cancer patients.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 193, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Waddell N, Pajic M, Patch AM, et al. Whole genomes redefine the mutational landscape of pancreatic cancer. Nature. 2015;518(7540):495-501.", "doi": "10.1038/nature14169", "nct": "", "pmid": 25719666, "source_id": 85, "source_type": "Journal", "url": "https://doi.org/10.1038/nature14169" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 194, "context": "Advanced, treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for niraparib for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status defined by either a deleterious or suspected deleterious BRCA mutation or genominc instability and who have progressed more than six months after response to the last platinum-based chemotherapy.", "disease": "Ovarian Epithelial Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 194, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "OVT", "oncotree_term": "Ovarian Epithelial Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline. Zejula (niraparib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 86, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 195, "context": "Treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for niraparib for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status defined by either a deleterious or suspected deleterious BRCA mutation or genominc instability and who have progressed more than six months after response to the last platinum-based chemotherapy.", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 195, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline. Zejula (niraparib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 86, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 196, "context": "Primary, treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for niraparib for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status defined by either a deleterious or suspected deleterious BRCA mutation or genominc instability and who have progressed more than six months after response to the last platinum-based chemotherapy.", "disease": "Peritoneal Serous Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 196, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "PSEC", "oncotree_term": "Peritoneal Serous Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline. Zejula (niraparib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 86, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 197, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 197, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 198, "context": "HRD-positive advanced", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration expanded the indication of olaparib to include its combination with bevacizumab for first-line maintenance treatment of adults with advanced epithelial ovarian, fallopian tube, or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy and whose cancer is associated with homologous recombination deficiency positive status defined by either a deleterious or suspected deleterious BRCA mutation, and/or genomic instability.", "disease": "Ovarian Epithelial Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 198, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "OVT", "oncotree_term": "Ovarian Epithelial Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 87, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bevacizumab + Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "VEGF/VEGFR inhibition + PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 199, "context": "HRD-positive advanced", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration expanded the indication of olaparib to include its combination with bevacizumab for first-line maintenance treatment of adults with advanced epithelial ovarian, fallopian tube, or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy and whose cancer is associated with homologous recombination deficiency positive status defined by either a deleterious or suspected deleterious BRCA mutation, and/or genomic instability.", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 199, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 87, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bevacizumab + Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "VEGF/VEGFR inhibition + PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 200, "context": "HRD-positive advanced", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration expanded the indication of olaparib to include its combination with bevacizumab for first-line maintenance treatment of adults with advanced epithelial ovarian, fallopian tube, or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy and whose cancer is associated with homologous recombination deficiency positive status defined by either a deleterious or suspected deleterious BRCA mutation, and/or genomic instability.", "disease": "Peritoneal Serous Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 200, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "PSEC", "oncotree_term": "Peritoneal Serous Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 87, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bevacizumab + Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "VEGF/VEGFR inhibition + PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 201, "context": "Advanced, treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for niraparib for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status defined by either a deleterious or suspected deleterious BRCA mutation or genominc instability and who have progressed more than six months after response to the last platinum-based chemotherapy.", "disease": "Ovarian Epithelial Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 201, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "OVT", "oncotree_term": "Ovarian Epithelial Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline. Zejula (niraparib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 86, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 202, "context": "Treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for niraparib for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status defined by either a deleterious or suspected deleterious BRCA mutation or genominc instability and who have progressed more than six months after response to the last platinum-based chemotherapy.", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 202, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline. Zejula (niraparib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 86, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 203, "context": "Primary, treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for niraparib for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status defined by either a deleterious or suspected deleterious BRCA mutation or genominc instability and who have progressed more than six months after response to the last platinum-based chemotherapy.", "disease": "Peritoneal Serous Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 203, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "PSEC", "oncotree_term": "Peritoneal Serous Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline. Zejula (niraparib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 86, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 204, "context": "Advanced", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for olaparib for the maintenance treatment of adult patients with deleterious or suspected deleterious germline or somatic BRCA-mutated advanced epithelial ovarian, fallopian tube or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy.", "disease": "Ovarian Epithelial Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 204, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "OVT", "oncotree_term": "Ovarian Epithelial Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12, 2020.", "doi": "", "nct": "NCT01844986", "pmid": "", "source_id": 81, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 205, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for olaparib for the maintenance treatment of adult patients with deleterious or suspected deleterious germline or somatic BRCA-mutated advanced epithelial ovarian, fallopian tube or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy.", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 205, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12, 2020.", "doi": "", "nct": "NCT01844986", "pmid": "", "source_id": 81, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 206, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for olaparib for the maintenance treatment of adult patients with deleterious or suspected deleterious germline or somatic BRCA-mutated advanced epithelial ovarian, fallopian tube or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy.", "disease": "Peritoneal Serous Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 206, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "PSEC", "oncotree_term": "Peritoneal Serous Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12, 2020.", "doi": "", "nct": "NCT01844986", "pmid": "", "source_id": 81, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 207, "context": "Previously treated with 2 or more chemotherapies", "created_on": "05/07/26", "deprecated": false, "description": "Rucaparib is indicated as monotherapy for the treatment of epithelial ovarian, fallopian tube, or primary peritoneal cancer with deleterious BRCA mutation (germline and/or somatic) as detected by a US FDA-approved test (available at http://www.fda.gov/CompanionDiagnostics) in patients who have been previously treated with 2 or more chemotherapies", "disease": "Ovarian Epithelial Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 207, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "OVT", "oncotree_term": "Ovarian Epithelial Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Clovis Oncology, Inc. Rucaparib (rucaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/209115s008lbl.pdf. Revised October 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 82, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/209115s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Rucaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 208, "context": "Previously treated with 2 or more chemotherapies", "created_on": "05/07/26", "deprecated": false, "description": "Rucaparib is indicated as monotherapy for the treatment of epithelial ovarian, fallopian tube, or primary peritoneal cancer with deleterious BRCA mutation (germline and/or somatic) as detected by a US FDA-approved test (available at http://www.fda.gov/CompanionDiagnostics) in patients who have been previously treated with 2 or more chemotherapies", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 208, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Clovis Oncology, Inc. Rucaparib (rucaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/209115s008lbl.pdf. Revised October 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 82, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/209115s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Rucaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 209, "context": "Previously treated with 2 or more chemotherapies", "created_on": "05/07/26", "deprecated": false, "description": "Rucaparib is indicated as monotherapy for the treatment of epithelial ovarian, fallopian tube, or primary peritoneal cancer with deleterious BRCA mutation (germline and/or somatic) as detected by a US FDA-approved test (available at http://www.fda.gov/CompanionDiagnostics) in patients who have been previously treated with 2 or more chemotherapies", "disease": "Peritoneal Serous Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 209, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "PSEC", "oncotree_term": "Peritoneal Serous Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Clovis Oncology, Inc. Rucaparib (rucaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/209115s008lbl.pdf. Revised October 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 82, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/209115s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Rucaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 210, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutations in BRCA1 or BRCA2 may predict sensitivity to PARP inhibition in ovarian cancer", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 210, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Fong PC, Yap TA, Boss DS, et al. Poly(ADP)-ribose polymerase inhibition: frequent durable responses in BRCA carrier ovarian cancer correlating with platinum-free interval. J Clin Oncol. 2010;28(15):2512-9.", "doi": "10.1200/JCO.2009.26.9589", "nct": "", "pmid": 20406929, "source_id": 83, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2009.26.9589" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 211, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Secondary mutations in BRCA2 may confer resistance to PARP inhibition in ovarian cancer", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 211, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Lheureux S, Bruce JP, Burnier JV, et al. Somatic BRCA1/2 Recovery as a Resistance Mechanism After Exceptional Response to Poly (ADP-ribose) Polymerase Inhibition. J Clin Oncol. 2017;:JCO2016713677.", "doi": "10.1200/JCO.2016.71.3677", "nct": "", "pmid": 28221868, "source_id": 84, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2016.71.3677" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 212, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Patients with chemotherapy-refractory prostate cancer have higher response rates to PARP inhibitor therapy in the presence of DNA repair mutations, particularly concomittant with platinum-sensitive disease. Platinum-resistant disease partially abrogates olaparib sensitvity in the setting of BRCA1 and BRCA2 mutations.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 212, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Mateo J, Carreira S, Sandhu S, et al. DNA-Repair Defects and Olaparib in Metastatic Prostate Cancer. N Engl J Med. 2015;373(18):1697-708.", "doi": "10.1056/NEJMoa1506859", "nct": "NCT01682772", "pmid": 26510020, "source_id": 88, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1506859" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 213, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "When present alongside genomic instability, defined by a large number of structural variation events, the inactivation of DNA maintenance genes (BRCA1, BRCA2, PALB2) was associated with increased sensitivity to platinum therapy in pancreatic cancer patients.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 213, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Waddell N, Pajic M, Patch AM, et al. Whole genomes redefine the mutational landscape of pancreatic cancer. Nature. 2015;518(7540):495-501.", "doi": "10.1038/nature14169", "nct": "", "pmid": 25719666, "source_id": 85, "source_type": "Journal", "url": "https://doi.org/10.1038/nature14169" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 214, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Responders were enriched for mutation in BRCA2 mutations, mostly nonsense mutations. 6 of 21 responders had BRCA2 vs. 1 of 17 nonresponders.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 214, "feature_type": "somatic_variant" } ], "last_updated": "2019-04-16", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Hugo W, Zaretsky JM, Sun L, et al. Genomic and Transcriptomic Features of Response to Anti-PD-1 Therapy in Metastatic Melanoma Cell. 2016; 165(1):35-44.", "doi": "10.1016/j.cell.2016.02.065", "nct": "", "pmid": 26997480, "source_id": 89, "source_type": "Journal", "url": "https://doi.org/10.1016/j.cell.2016.02.065" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nivolumab + Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 215, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 215, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 216, "context": "HRD-positive advanced", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration expanded the indication of olaparib to include its combination with bevacizumab for first-line maintenance treatment of adults with advanced epithelial ovarian, fallopian tube, or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy and whose cancer is associated with homologous recombination deficiency positive status defined by either a deleterious or suspected deleterious BRCA mutation, and/or genomic instability.", "disease": "Ovarian Epithelial Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 216, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "OVT", "oncotree_term": "Ovarian Epithelial Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 87, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bevacizumab + Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "VEGF/VEGFR inhibition + PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 217, "context": "HRD-positive advanced", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration expanded the indication of olaparib to include its combination with bevacizumab for first-line maintenance treatment of adults with advanced epithelial ovarian, fallopian tube, or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy and whose cancer is associated with homologous recombination deficiency positive status defined by either a deleterious or suspected deleterious BRCA mutation, and/or genomic instability.", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 217, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 87, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bevacizumab + Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "VEGF/VEGFR inhibition + PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 218, "context": "HRD-positive advanced", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration expanded the indication of olaparib to include its combination with bevacizumab for first-line maintenance treatment of adults with advanced epithelial ovarian, fallopian tube, or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy and whose cancer is associated with homologous recombination deficiency positive status defined by either a deleterious or suspected deleterious BRCA mutation, and/or genomic instability.", "disease": "Peritoneal Serous Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 218, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "PSEC", "oncotree_term": "Peritoneal Serous Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 87, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bevacizumab + Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "VEGF/VEGFR inhibition + PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 219, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRIP1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 219, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 220, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRIP1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 220, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 221, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRIP1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 221, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 222, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRIP1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 222, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 223, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRIP1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 223, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 224, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRIP1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 224, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 225, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRIP1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 225, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 226, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CDK12", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 226, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 227, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CHEK1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 227, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 228, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CHEK1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 228, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 229, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CHEK1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 229, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 230, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CHEK1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 230, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 231, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CHEK1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 231, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 232, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CHEK1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 232, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 233, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CHEK1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 233, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 234, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CHEK2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 234, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 235, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CHEK2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 235, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 236, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CHEK2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 236, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 237, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CHEK2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 237, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 238, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CHEK2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 238, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 239, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CHEK2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 239, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 240, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CHEK2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 240, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 241, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Tumors harboring mutations in the WNT pathway, such as CTNNB1, have extremely good prognosis.", "disease": "Medulloblastoma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CTNNB1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 241, "feature_type": "somatic_variant" } ], "last_updated": "2019-09-12", "oncotree_code": "MBL", "oncotree_term": "Medulloblastoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Northcott PA, Korshunov A, Witt H, et al. Medulloblastoma Comprises Four Distinct Molecular Variants JCO. 2011; 29(11):1408-1414.", "doi": "10.1200/JCO.2009.27.4324", "nct": "", "pmid": 20823417, "source_id": 90, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2009.27.4324" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 242, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to osimertinib, a kinase inhibitor, for the treatment of adult patients with metastatic epidermal growth factor receptor (EGFR) T790M mutation positive non-small cell lung cancer (NSCLC), as detected by an FDA approved test, whose disease has progressed on or after EGFR TKI therapy.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2369C>T", "chromosome": "7", "end_position": "55249071", "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.T790M", "reference_allele": "C", "rsid": "rs121434569", "start_position": "55249071", "variant_annotation": "Missense" } ], "feature_id": 242, "feature_type": "somatic_variant" } ], "last_updated": "2024-10-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Tagrisso (osimertinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2017/208065s006lbl.pdf. Revised March 2017. Accessed March 4, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 91, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2017/208065s006lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Osimertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 243, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Erlotinib (Tarceva) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with EGFR mutant metastatic non-small cell lung cancer. Mutant EGFR may suggest sensitivity to Erlotinib as a first or subsequent line of therapy.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 243, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.1.2017. \u00a9 National Comprehensive Cancer Network, Inc. 2017. All rights reserved. Accessed November 5, 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 20, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Erlotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 244, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Gefitinib (Iressa) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with EGFR mutant metastatic non-small cell lung cancer as a first or subsequent line of therapy.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 244, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.1.2017. \u00a9 National Comprehensive Cancer Network, Inc. 2017. All rights reserved. Accessed November 5, 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 20, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Gefitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 245, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Gefitinib (Iressa) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with second-site mutations within the EGFR kinase domain, such as p.T790M, as they are associated with acquired resistance to EGFR TKIs.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2369C>T", "chromosome": "7", "end_position": "55249071", "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.T790M", "reference_allele": "C", "rsid": "rs121434569", "start_position": "55249071", "variant_annotation": "Missense" } ], "feature_id": 245, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.1.2017. \u00a9 National Comprehensive Cancer Network, Inc. 2017. All rights reserved. Accessed November 5, 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 20, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Gefitinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 246, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Afatinib (Gilotrif) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with EGFR mutant metastatic non-small cell lung cancer as a first or subsequent line of therapy.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 246, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.1.2017. \u00a9 National Comprehensive Cancer Network, Inc. 2017. All rights reserved. Accessed November 5, 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 20, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Afatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 247, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Gefitinib (Iressa) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with EGFR mutant non-small cell lung cancer. There is significant association between EGFR mutants and sensitivity to EGFR TKIs.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 247, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.1.2017. \u00a9 National Comprehensive Cancer Network, Inc. 2017. All rights reserved. Accessed November 5, 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 20, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Gefitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 248, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Gefitinib (Iressa) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with non-small cell lung cancer whose tumors harbor EGFR exon 20 insertion variants, as these mutations may predict resistance to TKIs.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Insertion" } ], "feature_id": 248, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.1.2017. \u00a9 National Comprehensive Cancer Network, Inc. 2017. All rights reserved. Accessed November 5, 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 20, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Gefitinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 249, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Durvalumab (a PD-L1 inhibitor), is being evaluated in combination with Osimertinib (an EGFR-TKI) in patients with sensitizing EGFR mutations or T790M.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2369C>T", "chromosome": "7", "end_position": "55249071", "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.T790M", "reference_allele": "C", "rsid": "rs121434569", "start_position": "55249071", "variant_annotation": "Missense" } ], "feature_id": 249, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Ahn MJ, Yang J, Yu H, et al. 136O: Osimertinib combined with durvalumab in EGFR-mutant non-small cell lung cancer: Results from the TATTON phase Ib trial. J Thorac Oncol. 2016;11(4 Suppl):S115.", "doi": "10.1016/S1556-0864(16)30246-5", "nct": "NCT02143466", "pmid": 27599705, "source_id": 92, "source_type": "Journal", "url": "https://doi.org/10.1016/S1556-0864(16)30246-5" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Durvalumab + Osimertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition + EGFR inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 250, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "HM61713 showed clinical activity in patients with an EGFR T790M mutation in a Phase I trial.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2369C>T", "chromosome": "7", "end_position": "55249071", "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.T790M", "reference_allele": "C", "rsid": "rs121434569", "start_position": "55249071", "variant_annotation": "Missense" } ], "feature_id": 250, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Park K, Lee J, Han J, et al. 1300: Efficacy and safety of BI 1482694 (HM61713), an EGFR mutant-specific inhibitor, in T790M-positive NSCLC at the recommended phase II dose Journal of Thoracic Oncology. 2016; 11(4):S113-.", "doi": "10.1016/S1556-0864(16)30243-X", "nct": "NCT01588145", "pmid": "", "source_id": 93, "source_type": "Journal", "url": "https://doi.org/10.1016/S1556-0864(16)30243-X" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olmutinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 251, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Cabozantinib (a dual MET-VEGF inhibitor) is being evaluated in patents with EGFR mutations.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 251, "feature_type": "somatic_variant" } ], "last_updated": "2019-01-29", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Ke EE, Wu YL. EGFR as a Pharmacological Target in EGFR-Mutant Non-Small-Cell Lung Cancer: Where Do We Stand Now?. Trends Pharmacol Sci. 2016;37(11):887-903.", "doi": "10.1016/j.tips.2016.09.003", "nct": "NCT01708954", "pmid": 27717507, "source_id": 94, "source_type": "Journal", "url": "https://doi.org/ 10.1016/j.tips.2016.09.003" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cabozantinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 252, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Capmatinib (a cMET inhibitor) is being evaluated in patients with EGFR mutations.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 252, "feature_type": "somatic_variant" } ], "last_updated": "2019-01-29", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Ke EE, Wu YL. EGFR as a Pharmacological Target in EGFR-Mutant Non-Small-Cell Lung Cancer: Where Do We Stand Now?. Trends Pharmacol Sci. 2016;37(11):887-903.", "doi": "10.1016/j.tips.2016.09.003", "nct": "NCT01708954", "pmid": 27717507, "source_id": 94, "source_type": "Journal", "url": "https://doi.org/ 10.1016/j.tips.2016.09.003" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Capmatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 253, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "AZD3759, a CNS-penetrant EGFR-TKI, is being evaluated in patients with activating EGFR mutations.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 253, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Ke EE, Wu YL. EGFR as a Pharmacological Target in EGFR-Mutant Non-Small-Cell Lung Cancer: Where Do We Stand Now?. Trends Pharmacol Sci. 2016;37(11):887-903.", "doi": "10.1016/j.tips.2016.09.003", "nct": "NCT01708954", "pmid": 27717507, "source_id": 94, "source_type": "Journal", "url": "https://doi.org/ 10.1016/j.tips.2016.09.003" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Zorifertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 254, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Dacomitinib is being evaluated in comparison with gefitinib for the treatment of locally advanced or metastatic non-small cell lung cancer.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2573T>G", "chromosome": "7", "end_position": "55259515", "exon": "21", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.L858R", "reference_allele": "T", "rsid": "rs121434568", "start_position": "55259515", "variant_annotation": "Missense" } ], "feature_id": 254, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-30", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Ke EE, Wu YL. EGFR as a Pharmacological Target in EGFR-Mutant Non-Small-Cell Lung Cancer: Where Do We Stand Now?. Trends Pharmacol Sci. 2016;37(11):887-903.", "doi": "10.1016/j.tips.2016.09.003", "nct": "NCT01708954", "pmid": 27717507, "source_id": 94, "source_type": "Journal", "url": "https://doi.org/ 10.1016/j.tips.2016.09.003" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dacomitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 255, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutant EGFR may suggest sensitivity to Icotinib as a first or subsequent line of therapy.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 255, "feature_type": "somatic_variant" } ], "last_updated": "2019-01-29", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Ke EE, Wu YL. EGFR as a Pharmacological Target in EGFR-Mutant Non-Small-Cell Lung Cancer: Where Do We Stand Now?. Trends Pharmacol Sci. 2016;37(11):887-903.", "doi": "10.1016/j.tips.2016.09.003", "nct": "NCT01708954", "pmid": 27717507, "source_id": 94, "source_type": "Journal", "url": "https://doi.org/ 10.1016/j.tips.2016.09.003" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Icotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 256, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Osimertinib is being evaluated in patients who have progressed following treatment with an EGFR TKI.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2369C>T", "chromosome": "7", "end_position": "55249071", "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.T790M", "reference_allele": "C", "rsid": "rs121434569", "start_position": "55249071", "variant_annotation": "Missense" } ], "feature_id": 256, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Ke EE, Wu YL. EGFR as a Pharmacological Target in EGFR-Mutant Non-Small-Cell Lung Cancer: Where Do We Stand Now?. Trends Pharmacol Sci. 2016;37(11):887-903.", "doi": "10.1016/j.tips.2016.09.003", "nct": "NCT01708954", "pmid": 27717507, "source_id": 94, "source_type": "Journal", "url": "https://doi.org/ 10.1016/j.tips.2016.09.003" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Osimertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 257, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Rociletinib was found to be effective in some patients in a 130-patient trial.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2369C>T", "chromosome": "7", "end_position": "55249071", "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.T790M", "reference_allele": "C", "rsid": "rs121434569", "start_position": "55249071", "variant_annotation": "Missense" } ], "feature_id": 257, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Sequist LV, Soria JC, Goldman JW, et al. Rociletinib in EGFR-mutated non-small-cell lung cancer. N Engl J Med. 2015;372(18):1700-9.", "doi": "10.1056/NEJMoa1413654", "nct": "NCT01526928", "pmid": 25923550, "source_id": 95, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1413654" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Rociletinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 258, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Amplification and mutation of EGFR was associated with better clinical outcomes in a trial of 66 non-small cell lung cancer patients who had experienced relapse after surgery.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 258, "feature_type": "somatic_variant" } ], "last_updated": "2025-01-08", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Takano T, Ohe Y, Sakamoto H, et al. Epidermal growth factor receptor gene mutations and increased copy numbers predict gefitinib sensitivity in patients with recurrent non-small-cell lung cancer. J Clin Oncol. 2005;23(28):6829-37.", "doi": "10.1200/JCO.2005.01.0793", "nct": "", "pmid": 15998907, "source_id": 96, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2005.01.0793" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Gefitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 259, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Osimertinib is FDA-Approved for metastatic non-small cell lung cancer patients with EGFR T790M mutations.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2369C>T", "chromosome": "7", "end_position": "55249071", "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.T790M", "reference_allele": "C", "rsid": "rs121434569", "start_position": "55249071", "variant_annotation": "Missense" } ], "feature_id": 259, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wang S, Cang S, Liu D. Third-generation inhibitors targeting EGFR T790M mutation in advanced non-small cell lung cancer. J Hematol Oncol. 2016;9:34.", "doi": "10.1186/s13045-016-0268-z", "nct": "", "pmid": 27071706, "source_id": 97, "source_type": "Journal", "url": "https://doi.org/10.1186/s13045-016-0268-z" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Osimertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 260, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "EGF816 demonstrated clinical activity in a Phase 1 trial of patients with L858R and T790M mutations.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2573T>G", "chromosome": "7", "end_position": "55259515", "exon": "21", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.L858R", "reference_allele": "T", "rsid": "rs121434568", "start_position": "55259515", "variant_annotation": "Missense" } ], "feature_id": 260, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wang S, Cang S, Liu D. Third-generation inhibitors targeting EGFR T790M mutation in advanced non-small cell lung cancer. J Hematol Oncol. 2016;9:34.", "doi": "10.1186/s13045-016-0268-z", "nct": "", "pmid": 27071706, "source_id": 97, "source_type": "Journal", "url": "https://doi.org/10.1186/s13045-016-0268-z" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nazartinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 261, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "EGF816 demonstrated clinical activity in a Phase 1 trial of patients with L858R and T790M mutations.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2369C>T", "chromosome": "7", "end_position": "55249071", "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.T790M", "reference_allele": "C", "rsid": "rs121434569", "start_position": "55249071", "variant_annotation": "Missense" } ], "feature_id": 261, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wang S, Cang S, Liu D. Third-generation inhibitors targeting EGFR T790M mutation in advanced non-small cell lung cancer. J Hematol Oncol. 2016;9:34.", "doi": "10.1186/s13045-016-0268-z", "nct": "", "pmid": 27071706, "source_id": 97, "source_type": "Journal", "url": "https://doi.org/10.1186/s13045-016-0268-z" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nazartinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 262, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PF-06747775, a small molecule inhibitor of EGFR T790M, is being evaluated in advanced NSCLC patients with EGFR mutations (del 19 and L858R with or without T790M).", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2573T>G", "chromosome": "7", "end_position": "55259515", "exon": "21", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.L858R", "reference_allele": "T", "rsid": "rs121434568", "start_position": "55259515", "variant_annotation": "Missense" } ], "feature_id": 262, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wang S, Cang S, Liu D. Third-generation inhibitors targeting EGFR T790M mutation in advanced non-small cell lung cancer. J Hematol Oncol. 2016;9:34.", "doi": "10.1186/s13045-016-0268-z", "nct": "", "pmid": 27071706, "source_id": 97, "source_type": "Journal", "url": "https://doi.org/10.1186/s13045-016-0268-z" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Mavelertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 263, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PF-06747775, a small molecule inhibitor of EGFR T790M, is being evaluated in advanced NSCLC patients with EGFR mutations (del 19 and L858R with or without T790M).", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2369C>T", "chromosome": "7", "end_position": "55249071", "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.T790M", "reference_allele": "C", "rsid": "rs121434569", "start_position": "55249071", "variant_annotation": "Missense" } ], "feature_id": 263, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wang S, Cang S, Liu D. Third-generation inhibitors targeting EGFR T790M mutation in advanced non-small cell lung cancer. J Hematol Oncol. 2016;9:34.", "doi": "10.1186/s13045-016-0268-z", "nct": "", "pmid": 27071706, "source_id": 97, "source_type": "Journal", "url": "https://doi.org/10.1186/s13045-016-0268-z" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Mavelertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 264, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "TKI therapy for patients with T790M has limited benefit.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2369C>T", "chromosome": "7", "end_position": "55249071", "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.T790M", "reference_allele": "C", "rsid": "rs121434569", "start_position": "55249071", "variant_annotation": "Missense" } ], "feature_id": 264, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Yu HA, Arcila ME, Hellmann MD, Kris MG, Ladanyi M, Riely GJ. Poor response to erlotinib in patients with tumors containing baseline EGFR T790M mutations found by routine clinical molecular testing Annals of Oncology. 2014; 25(2):423-428.", "doi": "10.1093/annonc/mdt573", "nct": "", "pmid": 24478319, "source_id": 98, "source_type": "Journal", "url": "https://doi.org/10.1093/annonc/mdt573" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Erlotinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 265, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "TKI therapy for patients with T790M has limited benefit.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2369C>T", "chromosome": "7", "end_position": "55249071", "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.T790M", "reference_allele": "C", "rsid": "rs121434569", "start_position": "55249071", "variant_annotation": "Missense" } ], "feature_id": 265, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Yu HA, Arcila ME, Hellmann MD, Kris MG, Ladanyi M, Riely GJ. Poor response to erlotinib in patients with tumors containing baseline EGFR T790M mutations found by routine clinical molecular testing Annals of Oncology. 2014; 25(2):423-428.", "doi": "10.1093/annonc/mdt573", "nct": "", "pmid": 24478319, "source_id": 98, "source_type": "Journal", "url": "https://doi.org/10.1093/annonc/mdt573" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Afatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 266, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for afatinib for treatment of patients with metastatic non-small cell lung cancer (NSCLC) whose tumors have non-resistant EGFR mutations as detected by an FDA-approved test. Safety and efficacy were not established for tumors with resistant EGFR mutations.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 266, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Boehringer Ingelheim Pharmaceuticals, Inc. Gilotrif (afatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/201292s015lbl.pdf. Revised October 2019. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 99, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/201292s015lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Afatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 267, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for afatinib for treatment of patients with metastatic non-small cell lung cancer (NSCLC) whose tumors have non-resistant EGFR mutations as detected by an FDA-approved test. Safety and efficacy were not established for tumors with resistant EGFR mutations. Most common non-resistant mutations were exon 21 L858R and exon 19 deletions.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 267, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Boehringer Ingelheim Pharmaceuticals, Inc. Gilotrif (afatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/201292s015lbl.pdf. Revised October 2019. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 99, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/201292s015lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Afatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 268, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for afatinib for treatment of patients with metastatic non-small cell lung cancer (NSCLC) whose tumors have non-resistant EGFR mutations as detected by an FDA-approved test. Safety and efficacy were not established for tumors with resistant EGFR mutations. Most common non-resistant mutations were exon 21 L858R and exon 19 deletions.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2573T>G", "chromosome": "7", "end_position": "55259515", "exon": "21", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.L858R", "reference_allele": "T", "rsid": "rs121434568", "start_position": "55259515", "variant_annotation": "Missense" } ], "feature_id": 268, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-30", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Boehringer Ingelheim Pharmaceuticals, Inc. Gilotrif (afatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/201292s015lbl.pdf. Revised October 2019. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 99, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/201292s015lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Afatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 269, "context": "Intracranial metastases", "created_on": "05/07/26", "deprecated": false, "description": "In a retrospective study of patients with NSCLC, tumors with EGFR mutations or EML4-ALK locations had improved in-field local control of brain metastases treated with gamma knife.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 269, "feature_type": "somatic_variant" } ], "last_updated": "2019-08-09", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Johung, Kimberly L. A Clinical Model for Identifying Radiosensitive Tumor Genotypes in Non-Small Cell Lung Cancer. Clin Cancer Res. 2013 Oct 1;19(19):5523-32.", "doi": "10.1158/1078-0432.CCR-13-0836", "nct": "", "pmid": 23897899, "source_id": 19, "source_type": "Journal", "url": "https://clincancerres.aacrjournals.org/content/19/19/5523.long" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Gamma knife", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 270, "context": "Advanced", "created_on": "05/07/26", "deprecated": false, "description": "In a phase 3 trial, EGFR mutant positive advanced NSCLC (n=556) patients observed significantly longer PFS when treated with osimertinib instead of standard EGFR-TKIs.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "19", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 270, "feature_type": "somatic_variant" } ], "last_updated": "2019-08-15", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Soria J, Ohe Y, Vansteenkiste J, et al. Osimertinib in Untreated -Mutated Advanced Non-Small-Cell Lung Cancer N Engl J Med. 2018; 378(2):113-125.", "doi": "10.1056/NEJMoa1713137", "nct": "", "pmid": 29151359, "source_id": 100, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1713137" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Osimertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 271, "context": "Advanced", "created_on": "05/07/26", "deprecated": false, "description": "In a phase 3 trial, EGFR mutant positive advanced NSCLC (n=556) patients observed significantly longer PFS when treated with osimertinib instead of standard EGFR-TKIs.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2573T>G", "chromosome": "7", "end_position": "55259515", "exon": "21", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.L858R", "reference_allele": "T", "rsid": "rs121434568", "start_position": "55259515", "variant_annotation": "Missense" } ], "feature_id": 271, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-30", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Soria J, Ohe Y, Vansteenkiste J, et al. Osimertinib in Untreated -Mutated Advanced Non-Small-Cell Lung Cancer N Engl J Med. 2018; 378(2):113-125.", "doi": "10.1056/NEJMoa1713137", "nct": "", "pmid": 29151359, "source_id": 100, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1713137" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Osimertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 272, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for osimertinib for adjuvant therapy after tumor resection in patients with non-small cell lung cancer (NSCLC) whose tumors have epidermal growth factor receptor (EGFR) exon 19 deletions, as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "19", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Deletion" } ], "feature_id": 272, "feature_type": "somatic_variant" } ], "last_updated": "2024-03-04", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Tagrisso (osimertinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208065s021lbl.pdf. Revised December 2020. Accessed February 2nd, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 101, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208065s021lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Osimertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 273, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for osimertinib for adjuvant therapy after tumor resection in patients with non-small cell lung cancer (NSCLC) whose tumors have epidermal growth factor receptor (EGFR) exon 21 L858R mutations, as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2573T>G", "chromosome": "7", "end_position": "55259515", "exon": "21", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.L858R", "reference_allele": "T", "rsid": "rs121434568", "start_position": "55259515", "variant_annotation": "Missense" } ], "feature_id": 273, "feature_type": "somatic_variant" } ], "last_updated": "2024-03-04", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Tagrisso (osimertinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208065s021lbl.pdf. Revised December 2020. Accessed February 2nd, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 101, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208065s021lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Osimertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 274, "context": "Locally advanced or metastatic disease which has progressed on or after platinum-based chemotherapy.", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted accelerated approval to amivantamab-vmjw for adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with epidermal growth factor receptor (EGFR) exon 20 insertion mutations, as detected by an FDA-approved test, whose disease has progressed on or after platinum-based chemotherapy.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Insertion" } ], "feature_id": 274, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Janssen Biotech, Inc. Rybrevant (amivantamab-vmjw) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/761210s000lbl.pdf. Revised May 2021. Accessed June 1st, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 102, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/761210s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Amivantamab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 275, "context": "Locally advanced or metastatic disease which has progressed on or after platinum-based chemotherapy.", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted accelerated approval to mobocertinib for the treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with epidermal growth factor receptor (EGFR) exon 20 insertion mutations, as detected by an FDA-approved test, whose disease has progressed on or after platinum-based chemotherapy.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Insertion" } ], "feature_id": 275, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-16", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Takeda Pharmaceuticals America, Inc. Exkivity (mobocertinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/215310s000lbl.pdf. Revised September 2021. Accessed September 16th, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 103, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/215310s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Mobocertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 276, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Missesnse mutations may predict sensitivity to HER2 inhibitors", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ERBB2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 276, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-10", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Hyman DM, Piha-Paul SA, Won H, et al. HER kinase inhibition in patients with HER2- and HER3-mutant cancers Nature. 2018; 554(7691):189-194.", "doi": "10.1038/nature25475", "nct": "", "pmid": 29420467, "source_id": 104, "source_type": "Journal", "url": "https://doi.org/10.1038/nature25475" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Neratinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 277, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Ado-trasuzumab emtansine (Kadcyla) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with non-small cell lung cancer whose tumors harbor variants in ERBB2.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ERBB2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 277, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.5.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12, 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 11, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Trastuzumab Emtansine", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition", "therapy_type": "Hormone therapy", "validated": true }, { "assertion_id": 278, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Missesnse mutations may predict sensitivity to HER2 inhibitors", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ERBB3", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 278, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-10", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Hyman DM, Piha-Paul SA, Won H, et al. HER kinase inhibition in patients with HER2- and HER3-mutant cancers Nature. 2018; 554(7691):189-194.", "doi": "10.1038/nature25475", "nct": "", "pmid": 29420467, "source_id": 104, "source_type": "Journal", "url": "https://doi.org/10.1038/nature25475" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Neratinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 279, "context": "Muscle-Invasive", "created_on": "05/07/26", "deprecated": false, "description": "Somatic mutations that occured in ERCC2 were enriched in responders relative to nonresponsers in a cohort of patients with muscle-invasive urothelial carcinoma who received neoadjuvant cisplatin-based chemotherapy followed by cystectomy.", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ERCC2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 279, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Liu D, Plimack ER, Hoffman-censits J, et al. Clinical Validation of Chemotherapy Response Biomarker ERCC2 in Muscle-Invasive Urothelial Bladder Carcinoma. JAMA Oncol. 2016;2(8):1094-6.", "doi": "10.1001/jamaoncol.2016.1056", "nct": "", "pmid": 27310333, "source_id": 105, "source_type": "Journal", "url": "https://doi.org/10.1001/jamaoncol.2016.1056" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cisplatin", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 280, "context": "Muscle-Invasive", "created_on": "05/07/26", "deprecated": false, "description": "Somatic mutations that occured in ERCC2 were enriched in responders relative to nonresponsers in a cohort of patients with muscle-invasive urothelial carcinoma who received neoadjuvant cisplatin-based chemotherapy followed by cystectomy.", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ERCC2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 280, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Van Allen, Eliezer M., et al. Somatic ERCC2 mutations correlate with cisplatin sensitivity in muscle-invasive urothelial carcinoma. Cancer discovery 4.10 (2014): 1140-1153.", "doi": "10.1158/2159-8290.CD-14-0623", "nct": "", "pmid": 25096233, "source_id": 106, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-14-0623" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cisplatin", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 281, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Rapid disease regression was notd in a patient with a ERFFI1 p.E384X nonsense variant when treated with erlotinib.", "disease": "Cholangiocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.1150G>T", "chromosome": "1", "end_position": "8073509", "exon": "4", "feature_type": "somatic_variant", "gene": "ERRFI1", "protein_change": "p.E384*", "reference_allele": "C", "rsid": null, "start_position": "8073509", "variant_annotation": "Nonsense" } ], "feature_id": 281, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "CHOL", "oncotree_term": "Cholangiocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Borad MJ, Champion MD, Egan JB, et al. Integrated genomic characterization reveals novel, therapeutically relevant drug targets in FGFR and EGFR pathways in sporadic intrahepatic cholangiocarcinoma. PLoS Genet. 2014;10(2):e1004135.", "doi": "10.1371/journal.pgen.1004135", "nct": "", "pmid": 24550739, "source_id": 23, "source_type": "Journal", "url": "https://doi.org/10.1371/journal.pgen.1004135" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Erlotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 282, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Nonsynonymous mutations in ESR1 were found in metastatic breast cancer patients that developed resistance to endrocrin therapy. These patients were treated with anti-estrogens (taxmoxifen and/or fulvestrant) and aromataste inhibitors (letrozole, anastrozole, and/or exemestane).", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ESR1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 282, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Robinson DR, Wu YM, Vats P, et al. Activating ESR1 mutations in hormone-resistant metastatic breast cancer. Nat Genet. 2013;45(12):1446-51.", "doi": "10.1038/ng.2823", "nct": "", "pmid": 24185510, "source_id": 107, "source_type": "Journal", "url": "https://doi.org/10.1038/ng.2823" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Letrozole + Tamoxifen", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Aromatase inhibition + ER signaling inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 283, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights nonsense and frameshift variants in ETV6 as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ETV6", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 283, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 284, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights nonsense and frameshift variants in ETV6 as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ETV6", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 284, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 285, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights nonsense and frameshift variants in EZH2 as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "EZH2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 285, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 286, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights nonsense and frameshift variants in EZH2 as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "EZH2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 286, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 287, "context": "Relapsed or refractory", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to tazemetostat, an EZH2 inhibitor, for adult patients with relapsed or refactory (R/R) follicular lymphoma (FL) whose tumors are positive for an EZH2 mutation as detected by an FDA-approved test and who have received at least 2 prior systemic therapies, and for adult patients with R/R FL who have no satisfactory alternative treatment options.", "disease": "Follicular Lymphoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1938C>A", "chromosome": "7", "end_position": "148508726", "exon": "16", "feature_type": "somatic_variant", "gene": "EZH2", "protein_change": "p.Y646*", "reference_allele": "G", "rsid": null, "start_position": "148508726", "variant_annotation": "Nonsense" } ], "feature_id": 287, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-10", "oncotree_code": "FL", "oncotree_term": "Follicular Lymphoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Epizyme, Inc. Tazverik (tazemetostat) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/213400s000lbl.pdf. Revised June 2020. Accessed November 4th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 108, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/213400s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tazemetostat", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EZH2 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 288, "context": "Relapsed or refractory", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to tazemetostat, an EZH2 inhibitor, for adult patients with relapsed or refactory (R/R) follicular lymphoma (FL) whose tumors are positive for an EZH2 mutation as detected by an FDA-approved test and who have received at least 2 prior systemic therapies, and for adult patients with R/R FL who have no satisfactory alternative treatment options.", "disease": "Follicular Lymphoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.1937A>T", "chromosome": "7", "end_position": "148508727", "exon": "16", "feature_type": "somatic_variant", "gene": "EZH2", "protein_change": "p.Y646F", "reference_allele": "T", "rsid": null, "start_position": "148508727", "variant_annotation": "Missense" } ], "feature_id": 288, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-10", "oncotree_code": "FL", "oncotree_term": "Follicular Lymphoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Epizyme, Inc. Tazverik (tazemetostat) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/213400s000lbl.pdf. Revised June 2020. Accessed November 4th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 108, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/213400s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tazemetostat", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EZH2 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 289, "context": "Relapsed or refractory", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to tazemetostat, an EZH2 inhibitor, for adult patients with relapsed or refactory (R/R) follicular lymphoma (FL) whose tumors are positive for an EZH2 mutation as detected by an FDA-approved test and who have received at least 2 prior systemic therapies, and for adult patients with R/R FL who have no satisfactory alternative treatment options.", "disease": "Follicular Lymphoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1936T>A", "chromosome": "7", "end_position": "148508728", "exon": "16", "feature_type": "somatic_variant", "gene": "EZH2", "protein_change": "p.Y646N", "reference_allele": "A", "rsid": null, "start_position": "148508728", "variant_annotation": "Missense" } ], "feature_id": 289, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-10", "oncotree_code": "FL", "oncotree_term": "Follicular Lymphoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Epizyme, Inc. Tazverik (tazemetostat) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/213400s000lbl.pdf. Revised June 2020. Accessed November 4th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 108, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/213400s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tazemetostat", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EZH2 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 290, "context": "Relapsed or refractory", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to tazemetostat, an EZH2 inhibitor, for adult patients with relapsed or refactory (R/R) follicular lymphoma (FL) whose tumors are positive for an EZH2 mutation as detected by an FDA-approved test and who have received at least 2 prior systemic therapies, and for adult patients with R/R FL who have no satisfactory alternative treatment options.", "disease": "Follicular Lymphoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.2045C>G", "chromosome": "7", "end_position": "148506467", "exon": "18", "feature_type": "somatic_variant", "gene": "EZH2", "protein_change": "p.A682G", "reference_allele": "G", "rsid": null, "start_position": "148506467", "variant_annotation": "Missense" } ], "feature_id": 290, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-10", "oncotree_code": "FL", "oncotree_term": "Follicular Lymphoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Epizyme, Inc. Tazverik (tazemetostat) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/213400s000lbl.pdf. Revised June 2020. Accessed November 4th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 108, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/213400s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tazemetostat", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EZH2 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 291, "context": "Relapsed or refractory", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to tazemetostat, an EZH2 inhibitor, for adult patients with relapsed or refactory (R/R) follicular lymphoma (FL) whose tumors are positive for an EZH2 mutation as detected by an FDA-approved test and who have received at least 2 prior systemic therapies, and for adult patients with R/R FL who have no satisfactory alternative treatment options.", "disease": "Follicular Lymphoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.2075C>T", "chromosome": "7", "end_position": "148506437", "exon": "18", "feature_type": "somatic_variant", "gene": "EZH2", "protein_change": "p.A692V", "reference_allele": "G", "rsid": null, "start_position": "148506437", "variant_annotation": "Missense" } ], "feature_id": 291, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-10", "oncotree_code": "FL", "oncotree_term": "Follicular Lymphoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Epizyme, Inc. Tazverik (tazemetostat) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/213400s000lbl.pdf. Revised June 2020. Accessed November 4th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 108, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/213400s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tazemetostat", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EZH2 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 292, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "FANCL", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 292, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 293, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Breast cancer tumor cell lines harboring deletions or mutations in FBXW7 are particularly sensitive to rapamycin treatment, FBXW7 may be a biomarker for human cancers susceptible to treatment with inhibitors of the mTOR pathway.", "disease": "Breast Invasive Ductal Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "FBXW7", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 293, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "IDC", "oncotree_term": "Breast Invasive Ductal Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Mao JH, Kim IJ, Wu D, et al. FBXW7 targets mTOR for degradation and cooperates with PTEN in tumor suppression. Science. 2008;321(5895):1499-502.", "doi": "10.1126/science.1162981", "nct": "", "pmid": 18787170, "source_id": 109, "source_type": "Journal", "url": "https://doi.org/10.1126/science.1162981" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Sirolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 294, "context": "Locally advanced or metastatic, progressed during or following at least one line of prior platinum containing chemotherapy including within 12 months of neoadjuvant or adjuvant platinum containing chemotherapy.", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to erdafitinib for the treatment of adult patients with locally advanced or metastatic urothelial carcinoma with susceptible FGFR3 genetic alterations, and has progressed during or following at least one line of systemic therapy, as determined by an FDA-approved companion diagnostic. Erdafitinib is not recommended for the treatment of patients who are eligible for and have not received prior PD-1 or PD-L1 inhibitor therapy.", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.742C>T", "chromosome": "4", "end_position": "1803564", "exon": "6", "feature_type": "somatic_variant", "gene": "FGFR3", "protein_change": "p.R248C", "reference_allele": "C", "rsid": "rs121913482", "start_position": "1803564", "variant_annotation": "Missense" } ], "feature_id": 294, "feature_type": "somatic_variant" } ], "last_updated": "2024-01-25", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Janssen Products, LP. Balversa (erdafitinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/212018s007s008s009lbl.pdf. Revised January 2024. Accessed January 25, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 26, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/212018s007s008s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Erdafitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 295, "context": "Locally advanced or metastatic, progressed during or following at least one line of prior platinum containing chemotherapy including within 12 months of neoadjuvant or adjuvant platinum containing chemotherapy.", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to erdafitinib for the treatment of adult patients with locally advanced or metastatic urothelial carcinoma with susceptible FGFR3 genetic alterations, and has progressed during or following at least one line of systemic therapy, as determined by an FDA-approved companion diagnostic. Erdafitinib is not recommended for the treatment of patients who are eligible for and have not received prior PD-1 or PD-L1 inhibitor therapy.", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.746C>G", "chromosome": "4", "end_position": "1803568", "exon": "6", "feature_type": "somatic_variant", "gene": "FGFR3", "protein_change": "p.S249C", "reference_allele": "C", "rsid": "rs121913483", "start_position": "1803568", "variant_annotation": "Missense" } ], "feature_id": 295, "feature_type": "somatic_variant" } ], "last_updated": "2024-01-25", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Janssen Products, LP. Balversa (erdafitinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/212018s007s008s009lbl.pdf. Revised January 2024. Accessed January 25, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 26, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/212018s007s008s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Erdafitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 296, "context": "Locally advanced or metastatic, progressed during or following at least one line of prior platinum containing chemotherapy including within 12 months of neoadjuvant or adjuvant platinum containing chemotherapy.", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to erdafitinib for the treatment of adult patients with locally advanced or metastatic urothelial carcinoma with susceptible FGFR3 genetic alterations, and has progressed during or following at least one line of systemic therapy, as determined by an FDA-approved companion diagnostic. Erdafitinib is not recommended for the treatment of patients who are eligible for and have not received prior PD-1 or PD-L1 inhibitor therapy.", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1180G>T", "chromosome": "4", "end_position": "1806089", "exon": "8", "feature_type": "somatic_variant", "gene": "FGFR3", "protein_change": "p.G370C", "reference_allele": "G", "rsid": "rs121913479", "start_position": "1806089", "variant_annotation": "Missense" } ], "feature_id": 296, "feature_type": "somatic_variant" } ], "last_updated": "2024-01-25", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Janssen Products, LP. Balversa (erdafitinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/212018s007s008s009lbl.pdf. Revised January 2024. Accessed January 25, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 26, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/212018s007s008s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Erdafitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 297, "context": "Locally advanced or metastatic, progressed during or following at least one line of prior platinum containing chemotherapy including within 12 months of neoadjuvant or adjuvant platinum containing chemotherapy.", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to erdafitinib for the treatment of adult patients with locally advanced or metastatic urothelial carcinoma with susceptible FGFR3 genetic alterations, and has progressed during or following at least one line of systemic therapy, as determined by an FDA-approved companion diagnostic. Erdafitinib is not recommended for the treatment of patients who are eligible for and have not received prior PD-1 or PD-L1 inhibitor therapy.", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1118A>G", "chromosome": "4", "end_position": "1806099", "exon": "8", "feature_type": "somatic_variant", "gene": "FGFR3", "protein_change": "p.Y373C", "reference_allele": "A", "rsid": "rs121913485", "start_position": "1806099", "variant_annotation": "Missense" } ], "feature_id": 297, "feature_type": "somatic_variant" } ], "last_updated": "2024-01-25", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Janssen Products, LP. Balversa (erdafitinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/212018s007s008s009lbl.pdf. Revised January 2024. Accessed January 25, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 26, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/212018s007s008s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Erdafitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 298, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function mutations in TSC1, TSC2, or FLCN may predict sensitivity to mTOR inhibition", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "FLCN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 298, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Iyer G, Hanrahan AJ, Milowsky MI, et al. Genome sequencing identifies a basis for everolimus sensitivity. Science. 2012;338(6104):221.", "doi": "10.1126/science.1226344", "nct": "", "pmid": 22923433, "source_id": 110, "source_type": "Journal", "url": "https://doi.org/10.1126/science.1226344" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 299, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function mutations in TSC1, TSC2, or FLCN may predict sensitivity to mTOR inhibition", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "FLCN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 299, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Iyer G, Hanrahan AJ, Milowsky MI, et al. Genome sequencing identifies a basis for everolimus sensitivity. Science. 2012;338(6104):221.", "doi": "10.1126/science.1226344", "nct": "", "pmid": 22923433, "source_id": 110, "source_type": "Journal", "url": "https://doi.org/10.1126/science.1226344" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 300, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function mutations in TSC1, TSC2, or FLCN may predict sensitivity to mTOR inhibition", "disease": "Anaplastic Thyroid Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "FLCN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 300, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "THAP", "oncotree_term": "Anaplastic Thyroid Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wagle N, Grabiner BC, Van allen EM, et al. Response and acquired resistance to everolimus in anaplastic thyroid cancer. N Engl J Med. 2014;371(15):1426-33.", "doi": "10.1056/NEJMoa1403352", "nct": "", "pmid": 25295501, "source_id": 111, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1403352" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 301, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function mutations in TSC1, TSC2, or FLCN may predict sensitivity to mTOR inhibition", "disease": "Anaplastic Thyroid Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "FLCN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 301, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "THAP", "oncotree_term": "Anaplastic Thyroid Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wagle N, Grabiner BC, Van allen EM, et al. Response and acquired resistance to everolimus in anaplastic thyroid cancer. N Engl J Med. 2014;371(15):1426-33.", "doi": "10.1056/NEJMoa1403352", "nct": "", "pmid": 25295501, "source_id": 111, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1403352" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 302, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function mutations in TSC1, TSC2, or FLCN may predict sensitivity to mTOR inhibition", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "FLCN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 302, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wagle N, Grabiner BC, Van allen EM, et al. Response and acquired resistance to everolimus in anaplastic thyroid cancer. N Engl J Med. 2014;371(15):1426-33.", "doi": "10.1056/NEJMoa1403352", "nct": "", "pmid": 25295501, "source_id": 111, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1403352" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 303, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function mutations in TSC1, TSC2, or FLCN may predict sensitivity to mTOR inhibition", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "FLCN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 303, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wagle N, Grabiner BC, Van allen EM, et al. Response and acquired resistance to everolimus in anaplastic thyroid cancer. N Engl J Med. 2014;371(15):1426-33.", "doi": "10.1056/NEJMoa1403352", "nct": "", "pmid": 25295501, "source_id": 111, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1403352" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 304, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A second FTL3 internal tanden duplication mutation (FTL3 p.F691L) was detected in a patient with acute myeloid leukemia at the time of relapse followed Quizartinib (AC220) treatment. Normal karyotype of NPM1 and FLT3-ITD was observed before treatment.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2071T>C", "chromosome": "13", "end_position": "28601361", "exon": "17", "feature_type": "somatic_variant", "gene": "FLT3", "protein_change": "p.F691L", "reference_allele": "A", "rsid": "rs759272576", "start_position": "28601361", "variant_annotation": "Missense" } ], "feature_id": 304, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Albers C, Leischner H, Verbeek M, et al. The secondary FLT3-ITD F691L mutation induces resistance to AC220 in FLT3-ITD+ AML but retains in vitro sensitivity to PKC412 and Sunitinib. Leukemia. 2013;27(6):1416-8.", "doi": "10.1038/leu.2013.14", "nct": "", "pmid": 23392356, "source_id": 112, "source_type": "Journal", "url": "https://doi.org/10.1038/leu.2013.14" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Quizartinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "targets FLT3", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 305, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Sunitinib successfully inhibits cellular proliferation of cells Ba/F3 FLT3 K663Q cells in a dose-dependent manner.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1987A>C", "chromosome": "13", "end_position": "28602381", "exon": "16", "feature_type": "somatic_variant", "gene": "FLT3", "protein_change": "p.K663Q", "reference_allele": "T", "rsid": "rs1057520026", "start_position": "28602381", "variant_annotation": "Missense" } ], "feature_id": 305, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "Preclinical", "sources": [ { "citation": "Schittenhelm MM, Yee KW, Tyner JW, et al. FLT3 K663Q is a novel AML-associated oncogenic kinase: Determination of biochemical properties and sensitivity to Sunitinib (SU11248). Leukemia. 2006;20(11):2008-14.", "doi": "10.1038/sj.leu.2404374", "nct": "", "pmid": 16990784, "source_id": 113, "source_type": "Journal", "url": "https://doi.org/10.1038/sj.leu.2404374" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Sunitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "targets FLT3", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 306, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "GATA3 mutation did not influence baseline Ki67 levels but was enriched in samples exhibiting greater percentage of Ki67 decline. While this requires further validation, it suggests that GATA3 mutation may be a positive marker for aromatase inhibitor response.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.881T>A", "chromosome": "10", "end_position": "8106058", "exon": "4", "feature_type": "somatic_variant", "gene": "GATA3", "protein_change": "p.M294K", "reference_allele": "T", "rsid": null, "start_position": "8106058", "variant_annotation": "Missense" } ], "feature_id": 306, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Ellis MJ, Ding L, Shen D, et al. Whole-genome analysis informs breast cancer response to aromatase inhibition. Nature. 2012;486(7403):353-60.", "doi": "10.1038/nature11143", "nct": "", "pmid": 22722193, "source_id": 114, "source_type": "Journal", "url": "https://doi.org/10.1038/nature11143" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Letrozole", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Aromatase inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 307, "context": "Relapsed or refractory", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for ivosidenib, a small molecule inhibitor of isocitrate dehydrogenase (IDH)1 on July 20, 2018, for treatment of adults with relapsed or refractory acute myeloid leukemia (R/R AML) with susceptible IDH1 mutation as detected by an FDA-approved test.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 307, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Agios Pharmaceuticals, Inc.. Tibsovo (ivosidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/211192s001lbl.pdf. Revised October 2020. Accessed November 12, 2020.", "doi": "", "nct": "NCT02074839", "pmid": "", "source_id": 115, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/211192s001lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ivosidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 308, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Alkylating chemotherapy is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with glioma harboring mutation of IDH1, as mutation of IDH1 is associated with a survival benefit in patients treated with alkylating chemotherapy, but not untreated patients.", "disease": "Glioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 308, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "GNOS", "oncotree_term": "Glioma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Glioma V.1.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 116, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cns_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Antineoplastic Alkylating Agent", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Alkylating chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 309, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutation of IDH1 is associated with a survival benefit in patients treated with alkylating chemotherapy (but not untreated patients).", "disease": "Glioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 309, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "GNOS", "oncotree_term": "Glioma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Glioma V.1.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 116, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cns_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 310, "context": "Newly diagnosed AML who are greater than or equal to 75 years of age and who have comorbidities that preclude the use of intensive induction chemotherapy. Relapsed or refractory AML.", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to ivosidenib, an isocitrate dehydrogenase-1 (IDH1) inhibitor, indicated for the treatment of adult patients with a susceptible IDH1 mutation as detected by an FDA approved test with newly-diagnosed AML who are greater than or equal to 75 years old or who have comorbidities that preclude the use of intensive induction chemotherapy as well as relapsed or refractory AML.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.395G>A", "chromosome": "2", "end_position": "209113112", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132H", "reference_allele": "C", "rsid": "rs121913500", "start_position": "209113112", "variant_annotation": "Missense" } ], "feature_id": 310, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-02", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Tibsovo (ivosidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/211192_s008lbl.pdf. Revised August 2021. Accessed September 2nd, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 117, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/211192_s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ivosidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 311, "context": "Newly diagnosed AML who are greater than or equal to 75 years of age and who have comorbidities that preclude the use of intensive induction chemotherapy. Relapsed or refractory AML.", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to ivosidenib, an isocitrate dehydrogenase-1 (IDH1) inhibitor, indicated for the treatment of adult patients with a susceptible IDH1 mutation as detected by an FDA approved test with newly-diagnosed AML who are greater than or equal to 75 years old or who have comorbidities that preclude the use of intensive induction chemotherapy as well as relapsed or refractory AML.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.394C>T", "chromosome": "2", "end_position": "209113113", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132C", "reference_allele": "G", "rsid": "rs121913499", "start_position": "209113113", "variant_annotation": "Missense" } ], "feature_id": 311, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-02", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Tibsovo (ivosidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/211192_s008lbl.pdf. Revised August 2021. Accessed September 2nd, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 117, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/211192_s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ivosidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 312, "context": "Locally advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to ivosidenib, an isocitrate dehydrogenase-1 (IDH1) inhibitor, indicated for the treatment of adult patients with a susceptible IDH1 mutation as detected by an FDA approved test with locally advanced or metastatic cholangiocarcinoma who have been previously treated.", "disease": "Cholangiocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.395G>A", "chromosome": "2", "end_position": "209113112", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132H", "reference_allele": "C", "rsid": "rs121913500", "start_position": "209113112", "variant_annotation": "Missense" } ], "feature_id": 312, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-02", "oncotree_code": "CHOL", "oncotree_term": "Cholangiocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Tibsovo (ivosidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/211192_s008lbl.pdf. Revised August 2021. Accessed September 2nd, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 117, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/211192_s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ivosidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 313, "context": "Locally advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to ivosidenib, an isocitrate dehydrogenase-1 (IDH1) inhibitor, indicated for the treatment of adult patients with a susceptible IDH1 mutation as detected by an FDA approved test with locally advanced or metastatic cholangiocarcinoma who have been previously treated.", "disease": "Cholangiocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.394C>T", "chromosome": "2", "end_position": "209113113", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132C", "reference_allele": "G", "rsid": "rs121913499", "start_position": "209113113", "variant_annotation": "Missense" } ], "feature_id": 313, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-02", "oncotree_code": "CHOL", "oncotree_term": "Cholangiocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Tibsovo (ivosidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/211192_s008lbl.pdf. Revised August 2021. Accessed September 2nd, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 117, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/211192_s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ivosidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 314, "context": "Newly diagnosed AML who are greater than or equal to 75 years of age and who have comorbidities that preclude the use of intensive induction chemotherapy. Relapsed or refractory AML.", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to ivosidenib, an isocitrate dehydrogenase-1 (IDH1) inhibitor, indicated for the treatment of adult patients with a susceptible IDH1 mutation as detected by an FDA approved test with newly-diagnosed AML who are greater than or equal to 75 years old or who have comorbidities that preclude the use of intensive induction chemotherapy as well as relapsed or refractory AML.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 314, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-02", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Tibsovo (ivosidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/211192_s008lbl.pdf. Revised August 2021. Accessed September 2nd, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 117, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/211192_s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ivosidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 315, "context": "Locally advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to ivosidenib, an isocitrate dehydrogenase-1 (IDH1) inhibitor, indicated for the treatment of adult patients with a susceptible IDH1 mutation as detected by an FDA approved test with locally advanced or metastatic cholangiocarcinoma who have been previously treated.", "disease": "Cholangiocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 315, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-02", "oncotree_code": "CHOL", "oncotree_term": "Cholangiocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Tibsovo (ivosidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/211192_s008lbl.pdf. Revised August 2021. Accessed September 2nd, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 117, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/211192_s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ivosidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 316, "context": "Relapsed or refractory", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted regular approval to enasidenib for the treatment of adult patients with relapsed or refractory acute myeloid leukemia with an isocitrate dehydrogenase-2 (IDH2) mutation as detected by an FDA-approved test.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.419G>A", "chromosome": "15", "end_position": "90631934", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH2", "protein_change": "p.R140Q", "reference_allele": "C", "rsid": "rs121913502", "start_position": "90631934", "variant_annotation": "Missense" } ], "feature_id": 316, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Celgene Corporation. Idhifa (enasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/209606s002lbl.pdf. Revised September 2019. Accessed November 12, 2020.", "doi": "", "nct": "NCT01915498", "pmid": "", "source_id": 118, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/209606s002lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH2 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 317, "context": "Relapsed or refractory", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted regular approval to enasidenib for the treatment of adult patients with relapsed or refractory acute myeloid leukemia with an isocitrate dehydrogenase-2 (IDH2) mutation as detected by an FDA-approved test.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.516G>T", "chromosome": "15", "end_position": "90631837", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH2", "protein_change": "p.R172S", "reference_allele": "C", "rsid": null, "start_position": "90631837", "variant_annotation": "Missense" } ], "feature_id": 317, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Celgene Corporation. Idhifa (enasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/209606s002lbl.pdf. Revised September 2019. Accessed November 12, 2020.", "doi": "", "nct": "NCT01915498", "pmid": "", "source_id": 118, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/209606s002lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH2 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 318, "context": "Relapsed or refractory", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted regular approval to enasidenib for the treatment of adult patients with relapsed or refractory acute myeloid leukemia with an isocitrate dehydrogenase-2 (IDH2) mutation as detected by an FDA-approved test.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.515G>A", "chromosome": "15", "end_position": "90631837", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH2", "protein_change": "p.R172K", "reference_allele": "C", "rsid": "rs121913503", "start_position": "90631837", "variant_annotation": "Missense" } ], "feature_id": 318, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Celgene Corporation. Idhifa (enasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/209606s002lbl.pdf. Revised September 2019. Accessed November 12, 2020.", "doi": "", "nct": "NCT01915498", "pmid": "", "source_id": 118, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/209606s002lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH2 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 319, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Alkylating chemotherapy is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with glioma harboring mutation of IDH2, as mutation of IDH2 is associated with a survival benefit in patients treated with alkylating chemotherapy, but not untreated patients.", "disease": "Glioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "15", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "IDH2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 319, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "GNOS", "oncotree_term": "Glioma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Glioma V.1.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 116, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cns_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Antineoplastic Alkylating Agent", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Alkylating chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 320, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutation of IDH2 is associated with a survival benefit in patients treated with alkylating chemotherapy, but not untreated patients.", "disease": "Glioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "15", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "IDH2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 320, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "GNOS", "oncotree_term": "Glioma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Glioma V.1.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 116, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cns_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 321, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights IDH2 p.R140Q and p.R172 variants as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.419G>A", "chromosome": "15", "end_position": "90631934", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH2", "protein_change": "p.R140Q", "reference_allele": "C", "rsid": null, "start_position": "90631934", "variant_annotation": "Missense" } ], "feature_id": 321, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 322, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights IDH2 p.R140Q and p.R172 variants as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.516G>T", "chromosome": "15", "end_position": "90631837", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH2", "protein_change": "p.R172S", "reference_allele": "C", "rsid": null, "start_position": "90631837", "variant_annotation": "Missense" } ], "feature_id": 322, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 323, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights IDH2 p.R140Q and p.R172 variants as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.515G>A", "chromosome": "15", "end_position": "90631837", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH2", "protein_change": "p.R172K", "reference_allele": "C", "rsid": "rs121913503", "start_position": "90631837", "variant_annotation": "Missense" } ], "feature_id": 323, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 324, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A study of target-specific sequencing data taken from 112 ALL patients showed an association between JAK1 or JAK2 mutation and decreased survival.", "disease": "B-Cell Acute Lymphoid Leukemia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "1", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "JAK1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 324, "feature_type": "somatic_variant" } ], "last_updated": "2019-04-30", "oncotree_code": "BALL", "oncotree_term": "B-Cell Acute Lymphoid Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Feng J, Li Y, Jia Y, et al. Spectrum of somatic mutations detected by targeted next-generation sequencing and their prognostic significance in adult patients with acute lymphoblastic leukemia. J Hematol Oncol. 2017;10(1):61.", "doi": "10.1186/s13045-017-0431-1", "nct": "", "pmid": 28245838, "source_id": 119, "source_type": "Journal", "url": "https://doi.org/10.1186/s13045-017-0431-1" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 325, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "MOHITO JAK1 V658F transplated mice were highly sensitive to growth inhibition by PU-H71.", "disease": "Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.1966G>T", "chromosome": "1", "end_position": "65312353", "exon": "14", "feature_type": "somatic_variant", "gene": "JAK1", "protein_change": "p.V656F", "reference_allele": "C", "rsid": null, "start_position": "65312353", "variant_annotation": "Missense" } ], "feature_id": 325, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "ALL", "oncotree_term": "Acute Lymphoid Leukemia", "predictive_implication": "Preclinical", "sources": [ { "citation": "Kucine N, Marubayashi S, Bhagwat N, et al. Tumor-specific HSP90 inhibition as a therapeutic approach in JAK-mutant acute lymphoblastic leukemias. Blood. 2015;126(22):2479-83.", "doi": "10.1182/blood-2015-03-635821", "nct": "", "pmid": 26443624, "source_id": 120, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2015-03-635821" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Zelavespib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "HSP90 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 326, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "MOHITO JAK1 A634D transplated mice were highly sensitive to growth inhibition by PU-H71.", "disease": "Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1901C>A", "chromosome": "1", "end_position": "65312418", "exon": "14", "feature_type": "somatic_variant", "gene": "JAK1", "protein_change": "p.A634D", "reference_allele": "G", "rsid": "rs869312953", "start_position": "65312418", "variant_annotation": "Missense" } ], "feature_id": 326, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "ALL", "oncotree_term": "Acute Lymphoid Leukemia", "predictive_implication": "Preclinical", "sources": [ { "citation": "Kucine N, Marubayashi S, Bhagwat N, et al. Tumor-specific HSP90 inhibition as a therapeutic approach in JAK-mutant acute lymphoblastic leukemias. Blood. 2015;126(22):2479-83.", "doi": "10.1182/blood-2015-03-635821", "nct": "", "pmid": 26443624, "source_id": 120, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2015-03-635821" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Zelavespib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "HSP90 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 327, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A study of target-specific sequencing data taken from 112 ALL patients showed an association between JAK1 or JAK2 mutation and decreased survival.", "disease": "B-Cell Acute Lymphoid Leukemia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "JAK2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 327, "feature_type": "somatic_variant" } ], "last_updated": "2019-04-30", "oncotree_code": "BALL", "oncotree_term": "B-Cell Acute Lymphoid Leukemia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Feng J, Li Y, Jia Y, et al. Spectrum of somatic mutations detected by targeted next-generation sequencing and their prognostic significance in adult patients with acute lymphoblastic leukemia. J Hematol Oncol. 2017;10(1):61.", "doi": "10.1186/s13045-017-0431-1", "nct": "", "pmid": 28245838, "source_id": 119, "source_type": "Journal", "url": "https://doi.org/10.1186/s13045-017-0431-1" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 328, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In a retrospective study of 244 patients, significantly more patients with a JAK2 V617F variant than without had complications (secondary fibrosis, hemorrhage, and thrombosis) and had received cytoreductive treatment.", "disease": "Myeloproliferative Neoplasm", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1849G>T", "chromosome": "9", "end_position": "5073770", "exon": "14", "feature_type": "somatic_variant", "gene": "JAK2", "protein_change": "p.V617F", "reference_allele": "G", "rsid": null, "start_position": "5073770", "variant_annotation": "Missense" } ], "feature_id": 328, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MPN", "oncotree_term": "Myeloproliferative Neoplasm", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Kralovics R, Passamonti F, Buser AS, et al. A gain-of-function mutation of JAK2 in myeloproliferative disorders. N Engl J Med. 2005;352(17):1779-90.", "doi": "10.1056/NEJMoa051113", "nct": "", "pmid": 15858187, "source_id": 121, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa051113" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 329, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Ba/F3 cell lines with mutant JAK3 were sensitive for low doses of ruxolitinib.", "disease": "T-Cell Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1714G>A", "chromosome": "19", "end_position": "17948010", "exon": "13", "feature_type": "somatic_variant", "gene": "JAK3", "protein_change": "p.A572T", "reference_allele": "C", "rsid": null, "start_position": "17948010", "variant_annotation": "Missense" } ], "feature_id": 329, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "TALL", "oncotree_term": "T-Cell Acute Lymphoid Leukemia", "predictive_implication": "Preclinical", "sources": [ { "citation": "Degryse S, De bock CE, Cox L, et al. JAK3 mutants transform hematopoietic cells through JAK1 activation, causing T-cell acute lymphoblastic leukemia in a mouse model. Blood. 2014;124(20):3092-100.", "doi": "10.1182/blood-2014-04-566687", "nct": "", "pmid": 25193870, "source_id": 122, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2014-04-566687" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ruxolitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "JAK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 330, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Ba/F3 cell lines with mutant JAK3 were sensitive for low doses of ruxolitinib.", "disease": "T-Cell Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1533G>A", "chromosome": "19", "end_position": "17949108", "exon": "11", "feature_type": "somatic_variant", "gene": "JAK3", "protein_change": "p.M511I", "reference_allele": "C", "rsid": null, "start_position": "17949108", "variant_annotation": "Missense" } ], "feature_id": 330, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "TALL", "oncotree_term": "T-Cell Acute Lymphoid Leukemia", "predictive_implication": "Preclinical", "sources": [ { "citation": "Degryse S, De bock CE, Cox L, et al. JAK3 mutants transform hematopoietic cells through JAK1 activation, causing T-cell acute lymphoblastic leukemia in a mouse model. Blood. 2014;124(20):3092-100.", "doi": "10.1182/blood-2014-04-566687", "nct": "", "pmid": 25193870, "source_id": 122, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2014-04-566687" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ruxolitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "JAK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 331, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Ba/F3 cell lines with mutant JAK3 were sensitive for low doses of ruxolitinib.", "disease": "T-Cell Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2570T>A", "chromosome": "19", "end_position": "17943438", "exon": "19", "feature_type": "somatic_variant", "gene": "JAK3", "protein_change": "p.L857Q", "reference_allele": "A", "rsid": null, "start_position": "17943438", "variant_annotation": "Missense" } ], "feature_id": 331, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "TALL", "oncotree_term": "T-Cell Acute Lymphoid Leukemia", "predictive_implication": "Preclinical", "sources": [ { "citation": "Degryse S, De bock CE, Cox L, et al. JAK3 mutants transform hematopoietic cells through JAK1 activation, causing T-cell acute lymphoblastic leukemia in a mouse model. Blood. 2014;124(20):3092-100.", "doi": "10.1182/blood-2014-04-566687", "nct": "", "pmid": 25193870, "source_id": 122, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2014-04-566687" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ruxolitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "JAK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 332, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Ba/F3 cell lines with mutant JAK3 were sensitive to Tofacitinib.", "disease": "T-Cell Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1714G>A", "chromosome": "19", "end_position": "17948010", "exon": "13", "feature_type": "somatic_variant", "gene": "JAK3", "protein_change": "p.A572T", "reference_allele": "C", "rsid": null, "start_position": "17948010", "variant_annotation": "Missense" } ], "feature_id": 332, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "TALL", "oncotree_term": "T-Cell Acute Lymphoid Leukemia", "predictive_implication": "Preclinical", "sources": [ { "citation": "Degryse S, De bock CE, Cox L, et al. JAK3 mutants transform hematopoietic cells through JAK1 activation, causing T-cell acute lymphoblastic leukemia in a mouse model. Blood. 2014;124(20):3092-100.", "doi": "10.1182/blood-2014-04-566687", "nct": "", "pmid": 25193870, "source_id": 122, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2014-04-566687" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tofacitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "JAK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 333, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Ba/F3 cell lines with mutant JAK3 were sensitive to Tofacitinib.", "disease": "T-Cell Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1533G>A", "chromosome": "19", "end_position": "17949108", "exon": "11", "feature_type": "somatic_variant", "gene": "JAK3", "protein_change": "p.M511I", "reference_allele": "C", "rsid": null, "start_position": "17949108", "variant_annotation": "Missense" } ], "feature_id": 333, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "TALL", "oncotree_term": "T-Cell Acute Lymphoid Leukemia", "predictive_implication": "Preclinical", "sources": [ { "citation": "Degryse S, De bock CE, Cox L, et al. JAK3 mutants transform hematopoietic cells through JAK1 activation, causing T-cell acute lymphoblastic leukemia in a mouse model. Blood. 2014;124(20):3092-100.", "doi": "10.1182/blood-2014-04-566687", "nct": "", "pmid": 25193870, "source_id": 122, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2014-04-566687" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tofacitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "JAK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 334, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Ba/F3 cell lines with mutant JAK3 were sensitive to Tofacitinib.", "disease": "T-Cell Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2570T>A", "chromosome": "19", "end_position": "17943438", "exon": "19", "feature_type": "somatic_variant", "gene": "JAK3", "protein_change": "p.L857Q", "reference_allele": "A", "rsid": null, "start_position": "17943438", "variant_annotation": "Missense" } ], "feature_id": 334, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "TALL", "oncotree_term": "T-Cell Acute Lymphoid Leukemia", "predictive_implication": "Preclinical", "sources": [ { "citation": "Degryse S, De bock CE, Cox L, et al. JAK3 mutants transform hematopoietic cells through JAK1 activation, causing T-cell acute lymphoblastic leukemia in a mouse model. Blood. 2014;124(20):3092-100.", "doi": "10.1182/blood-2014-04-566687", "nct": "", "pmid": 25193870, "source_id": 122, "source_type": "Journal", "url": "https://doi.org/10.1182/blood-2014-04-566687" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tofacitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "JAK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 335, "context": "Unresectable and/or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for imatinib for patients with Kit (CD117) positive unresectable and/or metastatic malignant gastrointestinal stromal tumors.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 335, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Gleevec (imatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021588s056s057lbl.pdf. Revised August 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 3, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021588s056s057lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 336, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "FDA-approved for (1) Patients with Kit (CD117) positive unresectable and/or metastatic malignant gastrointestinal stromal tumors (GIST) and (2) Adjuvant treatment of adult patients following resection of Kit (CD117) positive GIST", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 336, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Gleevec (imatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021588s056s057lbl.pdf. Revised August 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 3, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021588s056s057lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 337, "context": "Locally advanced, unresectable or metastatic gastrointestinal stromal tumor (GIST) who have been previously treated with imatinib mesylate and sunitinib malate.", "created_on": "05/07/26", "deprecated": false, "description": "FDA-approved for locally advanced, unresectable or metastatic gastrointestinal stromal tumor (GIST) who have been previously treated with imatinib mesylate and sunitinib malate.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 337, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Bayer HealthCare Pharmaceuticals, Inc. Stivarga (regorafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/203085s013lbl.pdf. Revised June 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 123, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/203085s013lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Regorafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 338, "context": "Locally advanced, unresectable or metastatic gastrointestinal stromal tumor (GIST) who have been previously treated with imatinib mesylate and sunitinib malate.", "created_on": "05/07/26", "deprecated": false, "description": "FDA-approved for locally advanced, unresectable or metastatic gastrointestinal stromal tumor (GIST) who have been previously treated with imatinib mesylate and sunitinib malate.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 338, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Bayer HealthCare Pharmaceuticals, Inc. Stivarga (regorafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/203085s013lbl.pdf. Revised June 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 123, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/203085s013lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Regorafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 339, "context": "Locally advanced, unresectable or metastatic gastrointestinal stromal tumor (GIST) who have been previously treated with imatinib mesylate and sunitinib malate.", "created_on": "05/07/26", "deprecated": false, "description": "FDA-approved for locally advanced, unresectable or metastatic gastrointestinal stromal tumor (GIST) who have been previously treated with imatinib mesylate and sunitinib malate.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2009C>T", "chromosome": "4", "end_position": "55595519", "exon": "14", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": "p.T670I", "reference_allele": "C", "rsid": "rs121913516", "start_position": "55595519", "variant_annotation": "Missense" } ], "feature_id": 339, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Bayer HealthCare Pharmaceuticals, Inc. Stivarga (regorafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/203085s013lbl.pdf. Revised June 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 123, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/203085s013lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Regorafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 340, "context": "Locally advanced, unresectable or metastatic gastrointestinal stromal tumor (GIST) who have been previously treated with imatinib mesylate and sunitinib malate.", "created_on": "05/07/26", "deprecated": false, "description": "FDA-approved for locally advanced, unresectable or metastatic gastrointestinal stromal tumor (GIST) who have been previously treated with imatinib mesylate and sunitinib malate.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1961T>C", "chromosome": "4", "end_position": "55594258", "exon": "13", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": "p.V654A", "reference_allele": "T", "rsid": "rs121913523", "start_position": "55594258", "variant_annotation": "Missense" } ], "feature_id": 340, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Bayer HealthCare Pharmaceuticals, Inc. Stivarga (regorafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/203085s013lbl.pdf. Revised June 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 123, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/203085s013lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Regorafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 341, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to Sunitinib for the treatment of gastrointestinal stromal tumor (GIST) after disease progression on or intolerance of imatinib mesylate.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 341, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Sutent (sunitinib malate) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021938s037lbl.pdf. Revised August 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 124, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021938s037lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Sunitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 342, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to Sunitinib for the treatment of gastrointestinal stromal tumor (GIST) after disease progression on or intolerance of imatinib mesylate.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2009C>T", "chromosome": "4", "end_position": "55595519", "exon": "14", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": "p.T670I", "reference_allele": "C", "rsid": "rs121913516", "start_position": "55595519", "variant_annotation": "Missense" } ], "feature_id": 342, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Sutent (sunitinib malate) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021938s037lbl.pdf. Revised August 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 124, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021938s037lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Sunitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 343, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to Sunitinib for the treatment of gastrointestinal stromal tumor (GIST) after disease progression on or intolerance of imatinib mesylate.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1961T>C", "chromosome": "4", "end_position": "55594258", "exon": "13", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": "p.V654A", "reference_allele": "T", "rsid": "rs121913523", "start_position": "55594258", "variant_annotation": "Missense" } ], "feature_id": 343, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Sutent (sunitinib malate) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021938s037lbl.pdf. Revised August 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 124, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/021938s037lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Sunitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 344, "context": "Mucosal Melanoma", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with head and neck mucosal melanoma. Mucosal melanoma is a rare and highly aggressive neoplasm with poor prognosis. Patients with this disease and mutations with c-KIT mutations (KIT exon 11 or 13) may be sensitive to c-KIT inhibitors.", "disease": "Head and Neck Mucosal Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 344, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "HNMUCM", "oncotree_term": "Head and Neck Mucosal Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Head and Neck Cancers V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": 20571149, "source_id": 125, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/head-and-neck_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 345, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with melanoma and KIT exon 11 and 13 variants; p.W557, p.V559, p.L576P, and p.K642E appear to have high level of sensitivity to KIT inhibition.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": "11", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 345, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Cutaneous Melanoma V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 126, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cutaneous_melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 346, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with melanoma and KIT exon 11 and 13 variants; p.W557, p.V559, p.L576P, and p.K642E appear to have high level of sensitivity to KIT inhibition.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": "13", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 346, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Cutaneous Melanoma V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 126, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cutaneous_melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 347, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with melanoma and KIT exon 11 and 13 variants; p.W557, p.V559, p.L576P, and p.K642E appear to have high level of sensitivity to KIT inhibition.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1671G>T", "chromosome": "4", "end_position": "55593605", "exon": "11", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": "p.W557C", "reference_allele": "G", "rsid": null, "start_position": "55593605", "variant_annotation": "Missense" } ], "feature_id": 347, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Cutaneous Melanoma V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 126, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cutaneous_melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 348, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with melanoma and KIT exon 11 and 13 variants; p.W557, p.V559, p.L576P, and p.K642E appear to have high level of sensitivity to KIT inhibition.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1669T>G", "chromosome": "4", "end_position": "55593603", "exon": "11", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": "p.W557G", "reference_allele": "T", "rsid": null, "start_position": "55593603", "variant_annotation": "Missense" } ], "feature_id": 348, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Cutaneous Melanoma V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 126, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cutaneous_melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 349, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with melanoma and KIT exon 11 and 13 variants; p.W557, p.V559, p.L576P, and p.K642E appear to have high level of sensitivity to KIT inhibition.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1669T>C", "chromosome": "4", "end_position": "55593603", "exon": "11", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": "p.W557R", "reference_allele": "T", "rsid": null, "start_position": "55593603", "variant_annotation": "Missense" } ], "feature_id": 349, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Cutaneous Melanoma V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 126, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cutaneous_melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 350, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with melanoma and KIT exon 11 and 13 variants; p.W557, p.V559, p.L576P, and p.K642E appear to have high level of sensitivity to KIT inhibition.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1676T>C", "chromosome": "4", "end_position": "55593610", "exon": "11", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": "p.V559A", "reference_allele": "T", "rsid": "rs121913517", "start_position": "55593610", "variant_annotation": "Missense" } ], "feature_id": 350, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Cutaneous Melanoma V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 126, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cutaneous_melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 351, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with melanoma and KIT exon 11 and 13 variants; p.W557, p.V559, p.L576P, and p.K642E appear to have high level of sensitivity to KIT inhibition.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1676T>G", "chromosome": "4", "end_position": "55593610", "exon": "11", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": "p.V559G", "reference_allele": "T", "rsid": "rs121913517", "start_position": "55593610", "variant_annotation": "Missense" } ], "feature_id": 351, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Cutaneous Melanoma V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 126, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cutaneous_melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 352, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with melanoma and KIT exon 11 and 13 variants; p.W557, p.V559, p.L576P, and p.K642E appear to have high level of sensitivity to KIT inhibition.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1727T>C", "chromosome": "4", "end_position": "55593661", "exon": "11", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": "p.L576P", "reference_allele": "T", "rsid": "rs121913513", "start_position": "55593661", "variant_annotation": "Missense" } ], "feature_id": 352, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Cutaneous Melanoma V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 126, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cutaneous_melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 353, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with melanoma and KIT exon 11 and 13 variants; p.W557, p.V559, p.L576P, and p.K642E appear to have high level of sensitivity to KIT inhibition.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1924A>G", "chromosome": "4", "end_position": "55594221", "exon": "13", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": "p.K642E", "reference_allele": "A", "rsid": null, "start_position": "55594221", "variant_annotation": "Missense" } ], "feature_id": 353, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Cutaneous Melanoma V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 126, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cutaneous_melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 354, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with melanoma and KIT exon 17 variants (p.D816H), these variants appear to have minimal or no sensitivity to KIT inhibitiors.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": "17", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 354, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Cutaneous Melanoma V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 126, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cutaneous_melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 355, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with melanoma and KIT exon 17 variants (p.D816H), these variants appear to have minimal or no sensitivity to KIT inhibitiors.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.2446G>C", "chromosome": "4", "end_position": "55599320", "exon": "17", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": "p.D816H", "reference_allele": "G", "rsid": "rs121913506", "start_position": "55599320", "variant_annotation": "Missense" } ], "feature_id": 355, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Cutaneous Melanoma V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 126, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cutaneous_melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 356, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with KIT mutant melanoma. Activating KIT mutations are associated with an increased sensitvity to imatinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 356, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Melanoma V.3.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 68, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 357, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with gastrointestinal stromal tumors and mutations in KIT exon 11. Approximately 90% of patients have diseases that respond to imatinib when their tumors have a KIT exon 11 mutation.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": "11", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 357, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Gastrointestinal Stromal Tumors V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 10 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 127, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/gist_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 358, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with gastrointestinal stromal tumors and mutations in KIT exon 9. Approximately 50% of patients have diseases that respond to imatinib when their tumors have a KIT exon 9 mutation, and the likelihood of response improves with use of 800 mg dosage rather than the standard 400 mg.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": "9", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 358, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Gastrointestinal Stromal Tumors V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 10 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 127, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/gist_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 359, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Sunitinib (Sutent) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with thymic carcinomas and c-KIT mutations.", "disease": "Thymic Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 359, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "THYC", "oncotree_term": "Thymic Carcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Thymomas and Thymic Carcinomas V.1.2021. \u00a9 National Comprehensive Cancer Network, Inc. 2021. All rights reserved. Accessed November 19 2020. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 128, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/thymic_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Sunitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 360, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Avapritnib inhibited the autophosphorylation of KIT p.D816V in cellular assays relative to wild-type KIT.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2447A>T", "chromosome": "4", "end_position": "55599321", "exon": "17", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": "p.D816V", "reference_allele": "A", "rsid": null, "start_position": "55599321", "variant_annotation": "Missense" } ], "feature_id": 360, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-02", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "Preclinical", "sources": [ { "citation": "Blueprint Medicines Corporation. Ayvakit (avapritinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/212608s007lbl.pdf. Revised June 2021. Accessed September 2nd, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 129, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/212608s007lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Avapritinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 361, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Avapritnib inhibited the the profileration of KIT mutant cell lines. Avapritnib also had anti-tumor activity in mice implanted with an imatinib-resistant patient-derived xenograft model of human GIST with an activating KIT exon 11 or 17 variant.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": "17", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 361, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-02", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "Preclinical", "sources": [ { "citation": "Blueprint Medicines Corporation. Ayvakit (avapritinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/212608s007lbl.pdf. Revised June 2021. Accessed September 2nd, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 129, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/212608s007lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Avapritinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 362, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Avapritnib inhibited the the profileration of KIT mutant cell lines.", "disease": "Mast Cell Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 362, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-02", "oncotree_code": "SMMCL", "oncotree_term": "Mast Cell Leukemia", "predictive_implication": "Preclinical", "sources": [ { "citation": "Blueprint Medicines Corporation. Ayvakit (avapritinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/212608s007lbl.pdf. Revised June 2021. Accessed September 2nd, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 129, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/212608s007lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Avapritinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 363, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Avapritnib had anti-tumor activity in mice implanted with an imatinib-resistant patient-derived xenograft model of human GIST with an activating KIT exon 11 or 17 variant.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": "11", "feature_type": "somatic_variant", "gene": "KIT", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 363, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-02", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "Preclinical", "sources": [ { "citation": "Blueprint Medicines Corporation. Ayvakit (avapritinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/212608s007lbl.pdf. Revised June 2021. Accessed September 2nd, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 129, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/212608s007lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Avapritinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 364, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The combination of palbociclib and trametinib has shown antitumor and radiosensitizing activity in preclinical models of non-small cell lung cancer, and is currently in a phase III clinical trial for non-small cell lung cancer.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 364, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-14", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Preclinical", "sources": [ { "citation": "Tao Z, Le blanc JM, Wang C, et al. Coadministration of Trametinib and Palbociclib Radiosensitizes KRAS-Mutant Non-Small Cell Lung Cancers In Vitro and In Vivo. Clin Cancer Res. 2016;22(1):122-33.", "doi": "10.1158/1078-0432.CCR-15-0589", "nct": "NCT02154490", "pmid": 26728409, "source_id": 130, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-15-0589" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Palbociclib + Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CDK4/6 inhibition + MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 365, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A phase 1b trial including 21 ovarian cancer patients demonstrated increased survival and an average PFS of 7 months when treated with a combination of buparlisib and trametinib (RP2D of buparlisib 60mg and trametinib 1.5mg daily).", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 365, "feature_type": "somatic_variant" } ], "last_updated": "2019-01-29", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Bedard PL, Tabernero J, Janku F, et al. A phase Ib dose-escalation study of the oral pan-PI3K inhibitor buparlisib (BKM120) in combination with the oral MEK1/2 inhibitor trametinib (GSK1120212) in patients with selected advanced solid tumors. Clin Cancer Res. 2015;21(4):730-8.", "doi": "10.1158/1078-0432.CCR-14-1814", "nct": "NCT01155453", "pmid": 25500057, "source_id": 131, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-14-1814" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Buparlisib + Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition + MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 366, "context": "Primary or Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Cetuximab (Erbitux) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with primary or metastatic colorectal cancer and known KRAS mutations (exon 2, 3, and 4).", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": "2", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 366, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.4.2018. \u00a9 National Comprehensive Cancer Network, Inc. 2018. All rights reserved. Accessed March 20 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 66, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cetuximab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 367, "context": "Primary or Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Panitumumab (Vectibix) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with primary or metastatic colorectal cancer and known KRAS mutations (exon 2, 3, and 4).", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": "2", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 367, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.4.2018. \u00a9 National Comprehensive Cancer Network, Inc. 2018. All rights reserved. Accessed March 20 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 66, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Panitumumab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 368, "context": "Primary or Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Cetuximab (Erbitux) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with primary or metastatic colorectal cancer and known KRAS mutations (exon 2, 3, and 4).", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": "3", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 368, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.4.2018. \u00a9 National Comprehensive Cancer Network, Inc. 2018. All rights reserved. Accessed March 20 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 66, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cetuximab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 369, "context": "Primary or Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Panitumumab (Vectibix) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with primary or metastatic colorectal cancer and known KRAS mutations (exon 2, 3, and 4).", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": "3", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 369, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.4.2018. \u00a9 National Comprehensive Cancer Network, Inc. 2018. All rights reserved. Accessed March 20 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 66, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Panitumumab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 370, "context": "Primary or Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Cetuximab (Erbitux) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with primary or metastatic colorectal cancer and known KRAS mutations (exon 2, 3, and 4).", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": "4", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 370, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.4.2018. \u00a9 National Comprehensive Cancer Network, Inc. 2018. All rights reserved. Accessed March 20 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 66, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cetuximab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 371, "context": "Primary or Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Panitumumab (Vectibix) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with primary or metastatic colorectal cancer and known KRAS mutations (exon 2, 3, and 4).", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": "4", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 371, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.4.2018. \u00a9 National Comprehensive Cancer Network, Inc. 2018. All rights reserved. Accessed March 20 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 66, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Panitumumab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 372, "context": "Locally advanced or metastatic disease", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted accelerated approval to sotorasib, a RAS GTPase family inhibitor, for adult patients with KRAS G12C mutated locally advanced or metastatic non-small cell lung cancer (NSCLC), as determined by an FDA approved test, who have received at least one prior systemic therapy.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.34G>T", "chromosome": "12", "end_position": "25398285", "exon": "2", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": "p.G12C", "reference_allele": "C", "rsid": "rs121913530", "start_position": "25398285", "variant_annotation": "Missense" } ], "feature_id": 372, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-30", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Amgen Inc. Lumakras (sotorasib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/214665s000lbl.pdf. Revised May 2021. Accessed June 1st, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 132, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/214665s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Sotorasib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RAS inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 373, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Gefitinib (Iressa) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with non-small cell lung cancer whose tumors harbor variants in KRAS, as these mutations are associated with intrinsic resistance to EGFR TKIs.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 373, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.1.2017. \u00a9 National Comprehensive Cancer Network, Inc. 2017. All rights reserved. Accessed November 5, 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 20, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Gefitinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 374, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "KRAS mutation G12D is associated with an increased risk of developing advanced pancreatic ductal carcinoma.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.35G>A", "chromosome": "12", "end_position": "25398284", "exon": "2", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": "p.G12D", "reference_allele": "C", "rsid": "rs121913529", "start_position": "25398284", "variant_annotation": "Missense" } ], "feature_id": 374, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Bournet B, Muscari F, Buscail C, et al. KRAS G12D Mutation Subtype Is A Prognostic Factor for Advanced Pancreatic Adenocarcinoma. Clin Transl Gastroenterol. 2016;7:e157.", "doi": "10.1038/ctg.2016.18", "nct": "", "pmid": 27010960, "source_id": 133, "source_type": "Journal", "url": "https://doi.org/10.1038/ctg.2016.18" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 375, "context": "Liver metastases from solid tumors", "created_on": "05/07/26", "deprecated": false, "description": "In a single-arm phase II trial of proton-based SBRT for liver metastases from solid tumors, KRAS mutation in codon 12, 13, or 61 was the strongest predictor of inferior local control.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": "2", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": "p.G12", "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 375, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Hong TS, Wo JY, Borger DR, et al. Phase II Study of Proton-Based Stereotactic Body Radiation Therapy for Liver Metastases: Importance of Tumor Genotype . 2017; 109(9).", "doi": "10.1093/jnci/djx031", "nct": "", "pmid": 28954285, "source_id": 134, "source_type": "Journal", "url": "https://doi.org/10.1093/jnci/djx031" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Proton Stereotactic Body Radiation Therapy", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 376, "context": "Liver metastases from solid tumors", "created_on": "05/07/26", "deprecated": false, "description": "In a single-arm phase II trial of proton-based SBRT for liver metastases from solid tumors, KRAS mutation in codon 12, 13, or 61 was the strongest predictor of inferior local control.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": "2", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": "p.G13", "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 376, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Hong TS, Wo JY, Borger DR, et al. Phase II Study of Proton-Based Stereotactic Body Radiation Therapy for Liver Metastases: Importance of Tumor Genotype . 2017; 109(9).", "doi": "10.1093/jnci/djx031", "nct": "", "pmid": 28954285, "source_id": 134, "source_type": "Journal", "url": "https://doi.org/10.1093/jnci/djx031" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Proton Stereotactic Body Radiation Therapy", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 377, "context": "Liver metastases from solid tumors", "created_on": "05/07/26", "deprecated": false, "description": "In a single-arm phase II trial of proton-based SBRT for liver metastases from solid tumors, KRAS mutation in codon 12, 13, or 61 was the strongest predictor of inferior local control.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": "3", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": "p.Q61", "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 377, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Hong TS, Wo JY, Borger DR, et al. Phase II Study of Proton-Based Stereotactic Body Radiation Therapy for Liver Metastases: Importance of Tumor Genotype . 2017; 109(9).", "doi": "10.1093/jnci/djx031", "nct": "", "pmid": 28954285, "source_id": 134, "source_type": "Journal", "url": "https://doi.org/10.1093/jnci/djx031" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Proton Stereotactic Body Radiation Therapy", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 378, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The combination of trametinib (a MEK inhibitor) with inhibition of FGFR1 is shown to enhance lung cancer and pancreatic cancer tumor cell death in vitro and in vivo.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 378, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Preclinical", "sources": [ { "citation": "Manchado E, Weissmueller S, Morris JP, et al. A combinatorial strategy for treating KRAS-mutant lung cancer. Nature. 2016;534(7609):647-651.", "doi": "10.1038/nature18600", "nct": "", "pmid": 27338794, "source_id": 135, "source_type": "Journal", "url": "https://doi.org/10.1038/nature18600" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "FGFR1 inhibitor + Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR1 inhibition + MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 379, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The combination of trametinib (a MEK inhibitor) with inhibition of FGFR1 is shown to enhance lung cancer and pancreatic cancer tumor cell death in vitro and in vivo.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 379, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Manchado E, Weissmueller S, Morris JP, et al. A combinatorial strategy for treating KRAS-mutant lung cancer. Nature. 2016;534(7609):647-651.", "doi": "10.1038/nature18600", "nct": "", "pmid": 27338794, "source_id": 135, "source_type": "Journal", "url": "https://doi.org/10.1038/nature18600" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "FGFR1 inhibitor + Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR1 inhibition + MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 380, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In a cohort of 34 non-small cell lung cancer patients treated with pembrolizumab, the presence of a KRAS mutation was associated with an increased chance of DCB.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 380, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Rizvi NA, Hellmann MD, Snyder A, et al. Cancer immunology. Mutational landscape determines sensitivity to PD-1 blockade in non-small cell lung cancer. Science. 2015;348(6230):124-8.", "doi": "10.1126/science.aaa1348", "nct": "", "pmid": 25765070, "source_id": 136, "source_type": "Journal", "url": "https://doi.org/10.1126/science.aaa1348" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 381, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "KRAS mutations were associated with resistance to the BRAF inhibitor PLX-4032 in a study of 109 microdissected pancreatic ductal adenocarcinoma patients.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 381, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Witkiewicz AK, Mcmillan EA, Balaji U, et al. Whole-exome sequencing of pancreatic cancer defines genetic diversity and therapeutic targets. Nat Commun. 2015;6:6744.", "doi": "10.1038/ncomms7744", "nct": "", "pmid": 25855536, "source_id": 54, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms7744" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vemurafenib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 382, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Preclinical study suggests that TBK1/IKKepsilon promote tumor survival by activating CCL5 and IL-6 and identify concurrent inhibition of TBK1/IKKepsilon, Janus-activated kinase (JAK), and MEK signaling as an effective approach to inhibit the actions of oncogenic KRAS", "disease": "Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 382, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "LEUK", "oncotree_term": "Leukemia", "predictive_implication": "Preclinical", "sources": [ { "citation": "Zhu Z, Aref AR, Cohoon TJ, et al. Inhibition of KRAS-driven tumorigenicity by interruption of an autocrine cytokine circuit. Cancer Discov. 2014;4(4):452-65.", "doi": "10.1158/2159-8290.CD-13-0646", "nct": "", "pmid": 24444711, "source_id": 137, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-13-0646" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Momelotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "JAK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 383, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Preclinical study suggests that TBK1/IKKepsilon promote tumor survival by activating CCL5 and IL-6 and identify concurrent inhibition of TBK1/IKKepsilon, Janus-activated kinase (JAK), and MEK signaling as an effective approach to inhibit the actions of oncogenic KRAS", "disease": "Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 383, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "LEUK", "oncotree_term": "Leukemia", "predictive_implication": "Preclinical", "sources": [ { "citation": "Zhu Z, Aref AR, Cohoon TJ, et al. Inhibition of KRAS-driven tumorigenicity by interruption of an autocrine cytokine circuit. Cancer Discov. 2014;4(4):452-65.", "doi": "10.1158/2159-8290.CD-13-0646", "nct": "", "pmid": 24444711, "source_id": 137, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-13-0646" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ruxolitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "JAK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 384, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In 17 rectal adenocarcinomas molecularly profiled pre- and post- chemoradiation, concurrent KRAS/TP53 mutations predicted non-responder status and worse PFS.", "disease": "Rectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 384, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "READ", "oncotree_term": "Rectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Kamran SC, Lennerz JK, Margolis CA, et al. Integrative Molecular Characterization of Resistance to Neoadjuvant Chemoradiation in Rectal Cancer Clin Cancer Res. 2019;", "doi": "10.1158/1078-0432.CCR-19-0908", "nct": "", "pmid": 31253631, "source_id": 138, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-19-0908" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Chemoradiotherapy", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Chemotherapy + Radiation", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 385, "context": "Early stage", "created_on": "05/07/26", "deprecated": false, "description": "In a retrosepctive series of early-stage NSCLC patients treated with SBRT, KRAS mutation was associated with decreased FFR and CSS.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 385, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Mak RH, Hermann G, Lewis JH, et al. Outcomes by Tumor Histology and KRAS Mutation Status After Lung Stereotactic Body Radiation Therapy for Early-Stage Non-Small-Cell Lung Cancer Clinical Lung Cancer. 2015; 16(1):24-32.", "doi": "10.1016/j.cllc.2014.09.005", "nct": "", "pmid": 25450872, "source_id": 139, "source_type": "Journal", "url": "https://doi.org/10.1016/j.cllc.2014.09.005" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Stereotactic Body Radiation Therapy", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 386, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant in vitro suggests resistance to PLX4720, a precursor to Vemurafenib, in metastatic melanoma.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.371C>T", "chromosome": "15", "end_position": "66729163", "exon": "3", "feature_type": "somatic_variant", "gene": "MAP2K1", "protein_change": "p.P124L", "reference_allele": "C", "rsid": null, "start_position": "66729163", "variant_annotation": "Missense" } ], "feature_id": 386, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Emery CM, Vijayendran KG, Zipser MC, et al. MEK1 mutations confer resistance to MEK and B-RAF inhibition. Proc Natl Acad Sci USA. 2009;106(48):20411-6.", "doi": "10.1073/pnas.0905833106", "nct": "", "pmid": 19915144, "source_id": 71, "source_type": "Journal", "url": "https://doi.org/10.1073/pnas.0905833106" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vemurafenib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 387, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant in vitro suggests resistance to PLX4720, a precursor to Vemurafenib, in metastatic melanoma.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.167A>C", "chromosome": "15", "end_position": "66727451", "exon": "2", "feature_type": "somatic_variant", "gene": "MAP2K1", "protein_change": "p.Q56P", "reference_allele": "A", "rsid": null, "start_position": "66727451", "variant_annotation": "Missense" } ], "feature_id": 387, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Emery CM, Vijayendran KG, Zipser MC, et al. MEK1 mutations confer resistance to MEK and B-RAF inhibition. Proc Natl Acad Sci USA. 2009;106(48):20411-6.", "doi": "10.1073/pnas.0905833106", "nct": "", "pmid": 19915144, "source_id": 71, "source_type": "Journal", "url": "https://doi.org/10.1073/pnas.0905833106" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vemurafenib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 388, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest resistance to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.371C>T", "chromosome": "15", "end_position": "66729163", "exon": "3", "feature_type": "somatic_variant", "gene": "MAP2K1", "protein_change": "p.P124L", "reference_allele": "C", "rsid": null, "start_position": "66729163", "variant_annotation": "Missense" } ], "feature_id": 388, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Emery CM, Vijayendran KG, Zipser MC, et al. MEK1 mutations confer resistance to MEK and B-RAF inhibition. Proc Natl Acad Sci USA. 2009;106(48):20411-6.", "doi": "10.1073/pnas.0905833106", "nct": "", "pmid": 19915144, "source_id": 71, "source_type": "Journal", "url": "https://doi.org/10.1073/pnas.0905833106" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 389, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Cell line NCI-H1437 harbors MAP2K1 p.Q56P, a known transformation-component allele of MEK1 originally identified in rat fibroblasts, and is sensitive to treatment with Selumetinib (AZD6244).", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.167A>C", "chromosome": "15", "end_position": "66727451", "exon": "2", "feature_type": "somatic_variant", "gene": "MAP2K1", "protein_change": "p.Q56P", "reference_allele": "A", "rsid": null, "start_position": "66727451", "variant_annotation": "Missense" } ], "feature_id": 389, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Preclinical", "sources": [ { "citation": "Marks JL, Gong Y, Chitale D, et al. Novel MEK1 mutation identified by mutational analysis of epidermal growth factor receptor signaling pathway genes in lung adenocarcinoma. Cancer Res. 2008;68(14):5524-8.", "doi": "10.1158/0008-5472.CAN-08-0099", "nct": "", "pmid": 18632602, "source_id": 140, "source_type": "Journal", "url": "https://doi.org/10.1158/0008-5472.CAN-08-0099" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 390, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "MEK1 Q56P confers resistance to monotherapy with RAF or MEK inhibitors in vitro.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.167A>C", "chromosome": "15", "end_position": "66727451", "exon": "2", "feature_type": "somatic_variant", "gene": "MAP2K1", "protein_change": "p.Q56P", "reference_allele": "A", "rsid": null, "start_position": "66727451", "variant_annotation": "Missense" } ], "feature_id": 390, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Trunzer, Kerstin, et al. Pharmacodynamic effects and mechanisms of resistance to vemurafenib in patients with metastatic melanoma. Journal of Clinical Oncology 31.14 (2013): 1767-1774.", "doi": "10.1200/JCO.2012.44.7888", "nct": "", "pmid": 23569304, "source_id": 141, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2012.44.7888" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vemurafenib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 391, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "MEK1 Q56P confers resistance to monotherapy with RAF or MEK inhibitors in vitro.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.167A>C", "chromosome": "15", "end_position": "66727451", "exon": "2", "feature_type": "somatic_variant", "gene": "MAP2K1", "protein_change": "p.Q56P", "reference_allele": "A", "rsid": null, "start_position": "66727451", "variant_annotation": "Missense" } ], "feature_id": 391, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Trunzer, Kerstin, et al. Pharmacodynamic effects and mechanisms of resistance to vemurafenib in patients with metastatic melanoma. Journal of Clinical Oncology 31.14 (2013): 1767-1774.", "doi": "10.1200/JCO.2012.44.7888", "nct": "", "pmid": 23569304, "source_id": 141, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2012.44.7888" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 392, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "MEK1 C121S confers resistance to monotherapy with RAF or MEK inhibitors in vitro.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.361T>A", "chromosome": "15", "end_position": "66729153", "exon": "3", "feature_type": "somatic_variant", "gene": "MAP2K1", "protein_change": "p.C121S", "reference_allele": "T", "rsid": null, "start_position": "66729153", "variant_annotation": "Missense" } ], "feature_id": 392, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Wagle N, Emery C, Berger MF, et al. Dissecting therapeutic resistance to RAF inhibition in melanoma by tumor genomic profiling. J Clin Oncol. 2011;29(22):3085-96.", "doi": "10.1200/JCO.2010.33.2312", "nct": "", "pmid": 21383288, "source_id": 142, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2010.33.2312" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vemurafenib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 393, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "MEK1 C121S confers resistance to monotherapy with RAF or MEK inhibitors in vitro.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.361T>A", "chromosome": "15", "end_position": "66729153", "exon": "3", "feature_type": "somatic_variant", "gene": "MAP2K1", "protein_change": "p.C121S", "reference_allele": "T", "rsid": null, "start_position": "66729153", "variant_annotation": "Missense" } ], "feature_id": 393, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Wagle N, Emery C, Berger MF, et al. Dissecting therapeutic resistance to RAF inhibition in melanoma by tumor genomic profiling. J Clin Oncol. 2011;29(22):3085-96.", "doi": "10.1200/JCO.2010.33.2312", "nct": "", "pmid": 21383288, "source_id": 142, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2010.33.2312" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 394, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "MEK2 Q60P was observed in a patient's trametinib resistant tumor but not pretreatment tumor.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.179A>C", "chromosome": "19", "end_position": "4117541", "exon": "2", "feature_type": "somatic_variant", "gene": "MAP2K2", "protein_change": "p.Q60P", "reference_allele": "T", "rsid": "rs1057519808", "start_position": "4117541", "variant_annotation": "Missense" } ], "feature_id": 394, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wagle, Nikhil, et al. MAP kinase pathway alterations in BRAF-mutant melanoma patients with acquired resistance to combined RAF/MEK inhibition. Cancer discovery 4.1 (2014): 61-68.", "doi": "10.1158/2159-8290.CD-13-0631", "nct": "", "pmid": 24265154, "source_id": 78, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-13-0631" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Trametinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 395, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In an exceptional responder, erlotinib resulted in complete and rapid response in MAPK1 mutant HNSCC", "disease": "Head and Neck Squamous Cell Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.964G>A", "chromosome": "22", "end_position": "22127164", "exon": "7", "feature_type": "somatic_variant", "gene": "MAPK1", "protein_change": "p.E322K", "reference_allele": "C", "rsid": null, "start_position": "22127164", "variant_annotation": "Missense" } ], "feature_id": 395, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "HNSC", "oncotree_term": "Head and Neck Squamous Cell Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Balbach ST, Orkin SH. An Achilles' Heel for MLL-Rearranged Leukemias: Writers and Readers of H3 Lysine 36 Dimethylation. Cancer Discov. 2016;6(7):700-2.", "doi": "10.1001/jamaoncol.2015.34", "nct": "", "pmid": 26181029, "source_id": 143, "source_type": "Journal", "url": "https://doi.org/10.1001/jamaoncol.2015.34" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Erlotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 396, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The presence of MC1R polymorphisms in a cohort of 53 metastatic melanoma patients treated with BRAF inhibitors was associated with a poorer prognosis (ORR: 59% vs. 95%; PFS shorter than 6 months: 72% vs. 33%).", "disease": "Melanoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "MC1R", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 396, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Guida M, Strippoli S, Ferretta A, et al. Detrimental effects of Melanocortin-1 receptor (MC1R) polymorphisms on the clinical outcomes of BRAF V600 metastatic melanoma patients treated with BRAF inhibitors. Pigment Cell Melanoma Res. 2016;", "doi": "10.1111/pcmr.12516", "nct": "", "pmid": 27540956, "source_id": 144, "source_type": "Journal", "url": "https://doi.org/10.1111/pcmr.12516" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 397, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to SU11274.", "disease": "Head and Neck Squamous Cell Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.3029C>T", "chromosome": "7", "end_position": "116411990", "exon": "14", "feature_type": "somatic_variant", "gene": "MET", "protein_change": "p.T1010I", "reference_allele": "C", "rsid": "rs56391007", "start_position": "116411990", "variant_annotation": "Missense" } ], "feature_id": 397, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "HNSC", "oncotree_term": "Head and Neck Squamous Cell Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Seiwert TY, Jagadeeswaran R, Faoro L, et al. The MET receptor tyrosine kinase is a potential novel therapeutic target for head and neck squamous cell carcinoma. Cancer Res. 2009;69(7):3021-31.", "doi": "10.1158/0008-5472.CAN-08-2881", "nct": "", "pmid": 19318576, "source_id": 145, "source_type": "Journal", "url": "https://doi.org/10.1158/0008-5472.CAN-08-2881" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "SU11274", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 398, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Crizotinib (Xalkori) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with metastatic non-small cell lung cancer whose tumors harbor MET exon 14 skipping variants.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "14", "feature_type": "somatic_variant", "gene": "MET", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 398, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.5.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12, 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 11, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Crizotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 399, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Crizotinib (Xalkori) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with metastatic non-small cell lung cancer whose tumors harbor MET exon 14 skipping variants.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "14", "feature_type": "somatic_variant", "gene": "MET", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Deletion" } ], "feature_id": 399, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.5.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12, 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 11, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Crizotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 400, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to capmatinib for adult patients with metastatic non-small cell lung cancer whose tumors have a mutation that leads to MET exon 14 skipping as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "14", "feature_type": "somatic_variant", "gene": "MET", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 400, "feature_type": "somatic_variant" } ], "last_updated": "2024-03-04", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Tabrecta (capmatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/213591s004lbl.pdf. Revised August 2022. Accessed March 4, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 146, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/213591s004lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Capmatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 401, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to capmatinib for adult patients with metastatic non-small cell lung cancer whose tumors have a mutation that leads to MET exon 14 skipping as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "14", "feature_type": "somatic_variant", "gene": "MET", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Deletion" } ], "feature_id": 401, "feature_type": "somatic_variant" } ], "last_updated": "2024-03-04", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Tabrecta (capmatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/213591s004lbl.pdf. Revised August 2022. Accessed March 4, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 146, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/213591s004lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Capmatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 402, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Patients with defects in DNA mismatch repair genes may have enhanced sensitivity to immune checkpoint blockade.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "MLH3", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 402, "feature_type": "somatic_variant" } ], "last_updated": "2023-10-31", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Le DT, Uram JN, Wang H, et al. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency. N Engl J Med. 2015;372(26):2509-20.", "doi": "10.1056/NEJMoa1500596", "nct": "NCT01876511", "pmid": 26028255, "source_id": 147, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1500596" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 403, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to JAK2 inhibition. This variant was observed to suggest sensitivity to EXEL-8232 in vivo.", "disease": "Myeloproliferative Neoplasm", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1544G>T", "chromosome": "1", "end_position": "43815009", "exon": "10", "feature_type": "somatic_variant", "gene": "MPL", "protein_change": "p.W515L", "reference_allele": "G", "rsid": "rs121913615", "start_position": "43815009", "variant_annotation": "Missense" } ], "feature_id": 403, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MPN", "oncotree_term": "Myeloproliferative Neoplasm", "predictive_implication": "Preclinical", "sources": [ { "citation": "Wernig G, Kharas MG, Mullally A, et al. EXEL-8232, a small-molecule JAK2 inhibitor, effectively treats thrombocytosis and extramedullary hematopoiesis in a murine model of myeloproliferative neoplasm induced by MPLW515L. Leukemia. 2012;26(4):720-7.", "doi": "10.1038/leu.2011.261", "nct": "", "pmid": 22005786, "source_id": 148, "source_type": "Journal", "url": "https://doi.org/10.1038/leu.2011.261" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "EXEL-8232", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "JAK2 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 404, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Patients with defects in DNA mismatch repair genes may have enhanced sensitivity to immune checkpoint blockade.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "MSH2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 404, "feature_type": "somatic_variant" } ], "last_updated": "2023-10-31", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Le DT, Uram JN, Wang H, et al. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency. N Engl J Med. 2015;372(26):2509-20.", "doi": "10.1056/NEJMoa1500596", "nct": "NCT01876511", "pmid": 26028255, "source_id": 147, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1500596" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 405, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Patients with defects in DNA mismatch repair genes may have enhanced sensitivity to immune checkpoint blockade.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "MSH6", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 405, "feature_type": "somatic_variant" } ], "last_updated": "2023-10-31", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Le DT, Uram JN, Wang H, et al. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency. N Engl J Med. 2015;372(26):2509-20.", "doi": "10.1056/NEJMoa1500596", "nct": "NCT01876511", "pmid": 26028255, "source_id": 147, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1500596" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 406, "context": "Advanced", "created_on": "05/07/26", "deprecated": false, "description": "In a study of 184 everolimus-treated patients with RCC from a phase 2 randomized trial, PFS neither differed on univariate analysis nor on multivariate testing based on variant status in TSC1, TSC2, or MTOR.", "disease": "Renal Clear Cell Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "MTOR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 406, "feature_type": "somatic_variant" } ], "last_updated": "2019-08-12", "oncotree_code": "RCC", "oncotree_term": "Renal Clear Cell Carcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Voss MH, Chen D, Reising A, et al. PTEN Expression, Not Mutation Status in, or, Correlates with the Outcome on Everolimus in Patients with Renal Cell Carcinoma Treated on the Randomized RECORD-3 Trial. Clin Cancer Res. 2019;25(2):506-514.", "doi": "10.1158/1078-0432.CCR-18-1833", "nct": "NCT00903175", "pmid": 30327302, "source_id": 149, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-18-1833" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 407, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Patients whose tumors contain DNA repair deficiencies may benefit from anti-PD-1 therapy. MMR deficient colorectal and noncolorectal cancer were enriched for partial response to Pembrolizumab in a cohort of 41 patients.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "MYH", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 407, "feature_type": "somatic_variant" } ], "last_updated": "2023-10-31", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Le DT, Uram JN, Wang H, et al. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency. N Engl J Med. 2015;372(26):2509-20.", "doi": "10.1056/NEJMoa1500596", "nct": "NCT01876511", "pmid": 26028255, "source_id": 147, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1500596" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 408, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In a study of survival after radiation in lung squamous cancer cell lines, NFE2L2 conferred radiation resistance.", "disease": "Lung Squamous Cell Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "NFE2L2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Activating mutation" } ], "feature_id": 408, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "LUSC", "oncotree_term": "Lung Squamous Cell Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Abazeed ME, Adams DJ, Hurov KE, et al. Integrative Radiogenomic Profiling of Squamous Cell Lung Cancer Cancer Research. 2013; 73(20):6289-6298.", "doi": "10.1158/0008-5472.can-13-1616", "nct": "", "pmid": 23980093, "source_id": 150, "source_type": "Journal", "url": "https://doi.org/10.1158/0008-5472.can-13-1616" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Radiation Therapy", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 409, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Cetuximab (Erbitux) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with primary or metastatic colorectal cancer and known KRAS mutations (exon 2, 3, and 4).", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "1", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 409, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.4.2018. \u00a9 National Comprehensive Cancer Network, Inc. 2018. All rights reserved. Accessed March 20 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 66, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cetuximab", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 410, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Panitumumab (Vectibix) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with primary or metastatic colorectal cancer and known KRAS mutations (exon 2, 3, and 4).", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "1", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 410, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.4.2018. \u00a9 National Comprehensive Cancer Network, Inc. 2018. All rights reserved. Accessed March 20 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 66, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Panitumumab", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 411, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights NRAS G12, G13, and Q61 variants as being associated with poor prognosis in patients with myelodysplastic syndromes, particularly in patients predicted to have lower-risk MDS.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.35G>C", "chromosome": "1", "end_position": "115258747", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G12A", "reference_allele": "C", "rsid": null, "start_position": "115258747", "variant_annotation": "Missense" } ], "feature_id": 411, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 412, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights NRAS G12, G13, and Q61 variants as being associated with poor prognosis in patients with myelodysplastic syndromes, particularly in patients predicted to have lower-risk MDS.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.34G>T", "chromosome": "1", "end_position": "115258748", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G12C", "reference_allele": "C", "rsid": "rs121913250", "start_position": "115258748", "variant_annotation": "Missense" } ], "feature_id": 412, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-30", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 413, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights NRAS G12, G13, and Q61 variants as being associated with poor prognosis in patients with myelodysplastic syndromes, particularly in patients predicted to have lower-risk MDS.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.35G>A", "chromosome": "1", "end_position": "115258747", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G12D", "reference_allele": "C", "rsid": null, "start_position": "115258747", "variant_annotation": "Missense" } ], "feature_id": 413, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 414, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights NRAS G12, G13, and Q61 variants as being associated with poor prognosis in patients with myelodysplastic syndromes, particularly in patients predicted to have lower-risk MDS.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "p.34G>C", "chromosome": "1", "end_position": "115258748", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G12R", "reference_allele": "C", "rsid": null, "start_position": "115258748", "variant_annotation": "Missense" } ], "feature_id": 414, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 415, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights NRAS G12, G13, and Q61 variants as being associated with poor prognosis in patients with myelodysplastic syndromes, particularly in patients predicted to have lower-risk MDS.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "p.34G>A", "chromosome": "1", "end_position": "115258748", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G12S", "reference_allele": "C", "rsid": null, "start_position": "115258748", "variant_annotation": "Missense" } ], "feature_id": 415, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 416, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights NRAS G12, G13, and Q61 variants as being associated with poor prognosis in patients with myelodysplastic syndromes, particularly in patients predicted to have lower-risk MDS.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "p.35G>T", "chromosome": "1", "end_position": "115258747", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G12V", "reference_allele": "C", "rsid": null, "start_position": "115258747", "variant_annotation": "Missense" } ], "feature_id": 416, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 417, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights NRAS G12, G13, and Q61 variants as being associated with poor prognosis in patients with myelodysplastic syndromes, particularly in patients predicted to have lower-risk MDS.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.38G>C", "chromosome": "1", "end_position": "115258744", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G13A", "reference_allele": "C", "rsid": "rs121434596", "start_position": "115258744", "variant_annotation": "Missense" } ], "feature_id": 417, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 418, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights NRAS G12, G13, and Q61 variants as being associated with poor prognosis in patients with myelodysplastic syndromes, particularly in patients predicted to have lower-risk MDS.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.38G>A", "chromosome": "1", "end_position": "115258744", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G13D", "reference_allele": "C", "rsid": null, "start_position": "115258744", "variant_annotation": "Missense" } ], "feature_id": 418, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 419, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights NRAS G12, G13, and Q61 variants as being associated with poor prognosis in patients with myelodysplastic syndromes, particularly in patients predicted to have lower-risk MDS.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.37G>C", "chromosome": "1", "end_position": "115258745", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G13R", "reference_allele": "C", "rsid": null, "start_position": "115258745", "variant_annotation": "Missense" } ], "feature_id": 419, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 420, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights NRAS G12, G13, and Q61 variants as being associated with poor prognosis in patients with myelodysplastic syndromes, particularly in patients predicted to have lower-risk MDS.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.38G>T", "chromosome": "1", "end_position": "115258744", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G13V", "reference_allele": "C", "rsid": "rs121434596", "start_position": "115258744", "variant_annotation": "Missense" } ], "feature_id": 420, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 421, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights NRAS G12, G13, and Q61 variants as being associated with poor prognosis in patients with myelodysplastic syndromes, particularly in patients predicted to have lower-risk MDS.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.181C>G", "chromosome": "1", "end_position": "115256530", "exon": "3", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.Q61E", "reference_allele": "G", "rsid": "rs121913254", "start_position": "115256530", "variant_annotation": "Missense" } ], "feature_id": 421, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 422, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights NRAS G12, G13, and Q61 variants as being associated with poor prognosis in patients with myelodysplastic syndromes, particularly in patients predicted to have lower-risk MDS.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.183A>T", "chromosome": "1", "end_position": "115256528", "exon": "3", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.Q61H", "reference_allele": "T", "rsid": "rs121913255", "start_position": "115256528", "variant_annotation": "Missense" } ], "feature_id": 422, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 423, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights NRAS G12, G13, and Q61 variants as being associated with poor prognosis in patients with myelodysplastic syndromes, particularly in patients predicted to have lower-risk MDS.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.182A>T", "chromosome": "1", "end_position": "115256529", "exon": "3", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.Q61L", "reference_allele": "T", "rsid": null, "start_position": "115256529", "variant_annotation": "Missense" } ], "feature_id": 423, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 424, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights NRAS G12, G13, and Q61 variants as being associated with poor prognosis in patients with myelodysplastic syndromes, particularly in patients predicted to have lower-risk MDS.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.182A>C", "chromosome": "1", "end_position": "115256529", "exon": "3", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.Q61P", "reference_allele": "T", "rsid": "rs11554290", "start_position": "115256529", "variant_annotation": "Missense" } ], "feature_id": 424, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 425, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.182A>G", "chromosome": "1", "end_position": "115256529", "exon": "3", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.Q61R", "reference_allele": "T", "rsid": null, "start_position": "115256529", "variant_annotation": "Missense" } ], "feature_id": 425, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Adjei AA, Cohen RB, Franklin W, et al. Phase I pharmacokinetic and pharmacodynamic study of the oral, small-molecule mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244 (ARRY-142886) in patients with advanced cancers. J Clin Oncol. 2008;26(13):2139-46.", "doi": "10.1200/JCO.2007.14.4956", "nct": "", "pmid": 18390968, "source_id": 151, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2007.14.4956" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 426, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.34G>T", "chromosome": "1", "end_position": "115258748", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G12C", "reference_allele": "C", "rsid": "rs121913250", "start_position": "115258748", "variant_annotation": "Missense" } ], "feature_id": 426, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-30", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Adjei AA, Cohen RB, Franklin W, et al. Phase I pharmacokinetic and pharmacodynamic study of the oral, small-molecule mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244 (ARRY-142886) in patients with advanced cancers. J Clin Oncol. 2008;26(13):2139-46.", "doi": "10.1200/JCO.2007.14.4956", "nct": "", "pmid": 18390968, "source_id": 151, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2007.14.4956" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 427, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.35G>A", "chromosome": "1", "end_position": "115258747", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G12D", "reference_allele": "C", "rsid": null, "start_position": "115258747", "variant_annotation": "Missense" } ], "feature_id": 427, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Adjei AA, Cohen RB, Franklin W, et al. Phase I pharmacokinetic and pharmacodynamic study of the oral, small-molecule mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244 (ARRY-142886) in patients with advanced cancers. J Clin Oncol. 2008;26(13):2139-46.", "doi": "10.1200/JCO.2007.14.4956", "nct": "", "pmid": 18390968, "source_id": 151, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2007.14.4956" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 428, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "p.34G>C", "chromosome": "1", "end_position": "115258748", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G12R", "reference_allele": "C", "rsid": null, "start_position": "115258748", "variant_annotation": "Missense" } ], "feature_id": 428, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Adjei AA, Cohen RB, Franklin W, et al. Phase I pharmacokinetic and pharmacodynamic study of the oral, small-molecule mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244 (ARRY-142886) in patients with advanced cancers. J Clin Oncol. 2008;26(13):2139-46.", "doi": "10.1200/JCO.2007.14.4956", "nct": "", "pmid": 18390968, "source_id": 151, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2007.14.4956" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 429, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "p.34G>A", "chromosome": "1", "end_position": "115258748", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G12S", "reference_allele": "C", "rsid": null, "start_position": "115258748", "variant_annotation": "Missense" } ], "feature_id": 429, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Adjei AA, Cohen RB, Franklin W, et al. Phase I pharmacokinetic and pharmacodynamic study of the oral, small-molecule mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244 (ARRY-142886) in patients with advanced cancers. J Clin Oncol. 2008;26(13):2139-46.", "doi": "10.1200/JCO.2007.14.4956", "nct": "", "pmid": 18390968, "source_id": 151, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2007.14.4956" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 430, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "p.35G>T", "chromosome": "1", "end_position": "115258747", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G12V", "reference_allele": "C", "rsid": null, "start_position": "115258747", "variant_annotation": "Missense" } ], "feature_id": 430, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Adjei AA, Cohen RB, Franklin W, et al. Phase I pharmacokinetic and pharmacodynamic study of the oral, small-molecule mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244 (ARRY-142886) in patients with advanced cancers. J Clin Oncol. 2008;26(13):2139-46.", "doi": "10.1200/JCO.2007.14.4956", "nct": "", "pmid": 18390968, "source_id": 151, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2007.14.4956" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 431, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.38G>C", "chromosome": "1", "end_position": "115258744", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G13A", "reference_allele": "C", "rsid": "rs121434596", "start_position": "115258744", "variant_annotation": "Missense" } ], "feature_id": 431, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Adjei AA, Cohen RB, Franklin W, et al. Phase I pharmacokinetic and pharmacodynamic study of the oral, small-molecule mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244 (ARRY-142886) in patients with advanced cancers. J Clin Oncol. 2008;26(13):2139-46.", "doi": "10.1200/JCO.2007.14.4956", "nct": "", "pmid": 18390968, "source_id": 151, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2007.14.4956" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 432, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.38G>A", "chromosome": "1", "end_position": "115258744", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G13D", "reference_allele": "C", "rsid": null, "start_position": "115258744", "variant_annotation": "Missense" } ], "feature_id": 432, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Adjei AA, Cohen RB, Franklin W, et al. Phase I pharmacokinetic and pharmacodynamic study of the oral, small-molecule mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244 (ARRY-142886) in patients with advanced cancers. J Clin Oncol. 2008;26(13):2139-46.", "doi": "10.1200/JCO.2007.14.4956", "nct": "", "pmid": 18390968, "source_id": 151, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2007.14.4956" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 433, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.37G>C", "chromosome": "1", "end_position": "115258745", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G13R", "reference_allele": "C", "rsid": null, "start_position": "115258745", "variant_annotation": "Missense" } ], "feature_id": 433, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Adjei AA, Cohen RB, Franklin W, et al. Phase I pharmacokinetic and pharmacodynamic study of the oral, small-molecule mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244 (ARRY-142886) in patients with advanced cancers. J Clin Oncol. 2008;26(13):2139-46.", "doi": "10.1200/JCO.2007.14.4956", "nct": "", "pmid": 18390968, "source_id": 151, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2007.14.4956" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 434, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.38G>T", "chromosome": "1", "end_position": "115258744", "exon": "2", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.G13V", "reference_allele": "C", "rsid": "rs121434596", "start_position": "115258744", "variant_annotation": "Missense" } ], "feature_id": 434, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Adjei AA, Cohen RB, Franklin W, et al. Phase I pharmacokinetic and pharmacodynamic study of the oral, small-molecule mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244 (ARRY-142886) in patients with advanced cancers. J Clin Oncol. 2008;26(13):2139-46.", "doi": "10.1200/JCO.2007.14.4956", "nct": "", "pmid": 18390968, "source_id": 151, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2007.14.4956" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 435, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.181C>G", "chromosome": "1", "end_position": "115256530", "exon": "3", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.Q61E", "reference_allele": "G", "rsid": "rs121913254", "start_position": "115256530", "variant_annotation": "Missense" } ], "feature_id": 435, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Adjei AA, Cohen RB, Franklin W, et al. Phase I pharmacokinetic and pharmacodynamic study of the oral, small-molecule mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244 (ARRY-142886) in patients with advanced cancers. J Clin Oncol. 2008;26(13):2139-46.", "doi": "10.1200/JCO.2007.14.4956", "nct": "", "pmid": 18390968, "source_id": 151, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2007.14.4956" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 436, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.183A>T", "chromosome": "1", "end_position": "115256528", "exon": "3", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.Q61H", "reference_allele": "T", "rsid": "rs121913255", "start_position": "115256528", "variant_annotation": "Missense" } ], "feature_id": 436, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Adjei AA, Cohen RB, Franklin W, et al. Phase I pharmacokinetic and pharmacodynamic study of the oral, small-molecule mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244 (ARRY-142886) in patients with advanced cancers. J Clin Oncol. 2008;26(13):2139-46.", "doi": "10.1200/JCO.2007.14.4956", "nct": "", "pmid": 18390968, "source_id": 151, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2007.14.4956" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 437, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.182A>T", "chromosome": "1", "end_position": "115256529", "exon": "3", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.Q61L", "reference_allele": "T", "rsid": null, "start_position": "115256529", "variant_annotation": "Missense" } ], "feature_id": 437, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Adjei AA, Cohen RB, Franklin W, et al. Phase I pharmacokinetic and pharmacodynamic study of the oral, small-molecule mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244 (ARRY-142886) in patients with advanced cancers. J Clin Oncol. 2008;26(13):2139-46.", "doi": "10.1200/JCO.2007.14.4956", "nct": "", "pmid": 18390968, "source_id": 151, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2007.14.4956" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 438, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.182A>C", "chromosome": "1", "end_position": "115256529", "exon": "3", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.Q61P", "reference_allele": "T", "rsid": "rs11554290", "start_position": "115256529", "variant_annotation": "Missense" } ], "feature_id": 438, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Adjei AA, Cohen RB, Franklin W, et al. Phase I pharmacokinetic and pharmacodynamic study of the oral, small-molecule mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244 (ARRY-142886) in patients with advanced cancers. J Clin Oncol. 2008;26(13):2139-46.", "doi": "10.1200/JCO.2007.14.4956", "nct": "", "pmid": 18390968, "source_id": 151, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2007.14.4956" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 439, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of this variant may suggest sensitivity to Selumetinib.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.182A>G", "chromosome": "1", "end_position": "115256529", "exon": "3", "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": "p.Q61R", "reference_allele": "T", "rsid": null, "start_position": "115256529", "variant_annotation": "Missense" } ], "feature_id": 439, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Adjei AA, Cohen RB, Franklin W, et al. Phase I pharmacokinetic and pharmacodynamic study of the oral, small-molecule mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244 (ARRY-142886) in patients with advanced cancers. J Clin Oncol. 2008;26(13):2139-46.", "doi": "10.1200/JCO.2007.14.4956", "nct": "", "pmid": 18390968, "source_id": 151, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2007.14.4956" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 440, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "A retrospective study of 677 metastatic melanoma patients found that patients with BRAF and NRAS mutations had a higher risk of CNS involvement at diagnosis of stage IV disease (24% of BRAF and 23% of NRAS compared to 12% WT). Non-uveal melanoma patients tested for mutations within a median 6 months of diagnosis (n=313) showed an association between BRAF and NRAS mutation and a shorter survival (median 8.2 months vs. 15.1 months).", "disease": "Melanoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "1", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "NRAS", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 440, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Jakob JA, Bassett RL, Ng CS, et al. NRAS mutation status is an independent prognostic factor in metastatic melanoma. Cancer. 2012;118(16):4014-23.", "doi": "10.1002/cncr.26724", "nct": "", "pmid": 22180178, "source_id": 152, "source_type": "Journal", "url": "https://doi.org/10.1002/cncr.26724" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 441, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PALB2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 441, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 442, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PALB2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 442, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 443, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PALB2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 443, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 444, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PALB2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 444, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 445, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PALB2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 445, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 446, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PALB2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 446, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 447, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "When present alongside genomic instability, defined by a large number of structural variation events, the inactivation of DNA maintenance genes (BRCA1, BRCA2, PALB2) was associated with increased sensitivity to platinum therapy in pancreatic cancer patients.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PALB2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 447, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Waddell N, Pajic M, Patch AM, et al. Whole genomes redefine the mutational landscape of pancreatic cancer. Nature. 2015;518(7540):495-501.", "doi": "10.1038/nature14169", "nct": "", "pmid": 25719666, "source_id": 85, "source_type": "Journal", "url": "https://doi.org/10.1038/nature14169" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 448, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PALB2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 448, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 449, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Clinical benefit from nivolumab in clear cell renal cell carcinoma patients was associated with loss-of-function mutations in PBRM1", "disease": "Renal Clear Cell Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PBRM1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 449, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-11", "oncotree_code": "CCRCC", "oncotree_term": "Renal Clear Cell Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Miao D, Margolis CA, Gao W, et al. Genomic correlates of response to immune checkpoint therapies in clear cell renal cell carcinoma. Science. 2018;359(6377):801-806.", "doi": "10.1126/science.aan5951", "nct": "", "pmid": 29301960, "source_id": 153, "source_type": "Journal", "url": "https://doi.org/10.1126/science.aan5951" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nivolumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 450, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with gastrointestinal stromal tumors and mutations in PDGFRA. Mutations in PDGFRA are associated with response to imatinib, with the exception of p.D842V.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PDGFRA", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 450, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Gastrointestinal Stromal Tumors V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 10 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 127, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/gist_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PDGF-R inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 451, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with gastrointestinal stromal tumors and mutations in PDGFRA. Mutations in PDGFRA are associated with response to imatinib, with the exception of p.D842V.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2525A>T", "chromosome": "4", "end_position": "55152093", "exon": "18", "feature_type": "somatic_variant", "gene": "PDGFRA", "protein_change": "p.D842V", "reference_allele": "A", "rsid": "rs121908585", "start_position": "55152093", "variant_annotation": "Missense" } ], "feature_id": 451, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Gastrointestinal Stromal Tumors V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 10 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 127, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/gist_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "PDGF-R inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 452, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Avapritnib inhibited the autophosphorylation of PDGFRA p.D842V in cellular assays.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2525A>T", "chromosome": "4", "end_position": "55152093", "exon": "18", "feature_type": "somatic_variant", "gene": "PDGFRA", "protein_change": "p.D842V", "reference_allele": "A", "rsid": "rs121908585", "start_position": "55152093", "variant_annotation": "Missense" } ], "feature_id": 452, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-02", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "Preclinical", "sources": [ { "citation": "Blueprint Medicines Corporation. Ayvakit (avapritinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/212608s007lbl.pdf. Revised June 2021. Accessed September 2nd, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 129, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/212608s007lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Avapritinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 453, "context": "Unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to avapritinib, a KIT inhibitor, for the treatment of adults with unresectable or metastatic GIST harboring a platelet-derived growth factor alpha (PDGFRA) exon 18 variant, including PDGFRA p.D842V.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "4", "end_position": null, "exon": "18", "feature_type": "somatic_variant", "gene": "PDGFRA", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 453, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-02", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Blueprint Medicines Corporation. Ayvakit (avapritinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/212608s007lbl.pdf. Revised June 2021. Accessed September 2nd, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 129, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/212608s007lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Avapritinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 454, "context": "Unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to avapritinib, a KIT inhibitor, for the treatment of adults with unresectable or metastatic GIST harboring a platelet-derived growth factor alpha (PDGFRA) exon 18 variant, including PDGFRA p.D842V.", "disease": "Gastrointestinal Stromal Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2525A>T", "chromosome": "4", "end_position": "55152093", "exon": "18", "feature_type": "somatic_variant", "gene": "PDGFRA", "protein_change": "p.D842V", "reference_allele": "A", "rsid": "rs121908585", "start_position": "55152093", "variant_annotation": "Missense" } ], "feature_id": 454, "feature_type": "somatic_variant" } ], "last_updated": "2021-09-02", "oncotree_code": "GIST", "oncotree_term": "Gastrointestinal Stromal Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Blueprint Medicines Corporation. Ayvakit (avapritinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/212608s007lbl.pdf. Revised June 2021. Accessed September 2nd, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 129, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/212608s007lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Avapritinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 455, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Clinical benefit from nivolumab in clear cell renal cell carcinoma patients was associated with loss-of-function mutations in PBRM1", "disease": "Renal Clear Cell Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PBRM1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 455, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-11", "oncotree_code": "CCRCC", "oncotree_term": "Renal Clear Cell Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Miao D, Margolis CA, Gao W, et al. Genomic correlates of response to immune checkpoint therapies in clear cell renal cell carcinoma. Science. 2018;359(6377):801-806.", "doi": "10.1126/science.aan5951", "nct": "", "pmid": 29301960, "source_id": 153, "source_type": "Journal", "url": "https://doi.org/10.1126/science.aan5951" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nivolumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 456, "context": "Advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Alpelisib is a kinase inhibitor indictated in combination with fulvestrant for the treatment of postmenopausal women, and men, with HR+, HER2-negative, PIK3CA mutated, advanced or metastatic breast cancer as detected by an FDA-approved test following progression on or after an endrocrine-based regime.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 456, "feature_type": "somatic_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Piqray (alpelisib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/212526s001lbl.pdf. Revised September 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 154, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/212526s001lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Alpelisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 457, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PIK3CA, but not AKT1 mutation, increased sensitivity to the PI3K inhibitor GDC-0941 and the allosteric AKT inhibitor MK-2206", "disease": "Breast Invasive Ductal Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "3", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 457, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "IDC", "oncotree_term": "Breast Invasive Ductal Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Beaver JA, Gustin JP, Yi KH, et al. PIK3CA and AKT1 mutations have distinct effects on sensitivity to targeted pathway inhibitors in an isogenic luminal breast cancer model system. Clin Cancer Res. 2013;19(19):5413-22.", "doi": "10.1158/1078-0432.CCR-13-0884", "nct": "", "pmid": 23888070, "source_id": 155, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-0884" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 458, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Median PFS was longer in patients with normal PTEN, TP53, and PIK3CA status.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "3", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 458, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Hussain M, Daignault-newton S, Twardowski PW, et al. Targeting Androgen Receptor and DNA Repair in Metastatic Castration-Resistant Prostate Cancer: Results From NCI 9012. J Clin Oncol. 2018;36(10):991-999.", "doi": "10.1200/JCO.2017.75.7310", "nct": "NCT01576172", "pmid": 29261439, "source_id": 44, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2017.75.7310" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 459, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1633G>C", "chromosome": "3", "end_position": "178936091", "exon": "10", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.E545Q", "reference_allele": "G", "rsid": "rs104886003", "start_position": "178936091", "variant_annotation": "Missense" } ], "feature_id": 459, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 460, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1258T>C", "chromosome": "3", "end_position": "178927980", "exon": "8", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.C420R", "reference_allele": "T", "rsid": "rs121913272", "start_position": "178927980", "variant_annotation": "Missense" } ], "feature_id": 460, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 461, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.1624G>A", "chromosome": "3", "end_position": "178936082", "exon": "10", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.E542K", "reference_allele": "G", "rsid": "rs121913273", "start_position": "178936082", "variant_annotation": "Missense" } ], "feature_id": 461, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 462, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1624G>C", "chromosome": "3", "end_position": "178936082", "exon": "10", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.E542Q", "reference_allele": "G", "rsid": "rs121913273", "start_position": "178936082", "variant_annotation": "Missense" } ], "feature_id": 462, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 463, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1634A>C", "chromosome": "3", "end_position": "178936092", "exon": "10", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.E545A", "reference_allele": "A", "rsid": "rs121913274", "start_position": "178936092", "variant_annotation": "Missense" } ], "feature_id": 463, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 464, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1635G>T", "chromosome": "3", "end_position": "178936093", "exon": "10", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.E545D", "reference_allele": "G", "rsid": "rs121913275", "start_position": "178936093", "variant_annotation": "Missense" } ], "feature_id": 464, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 465, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1635G>T", "chromosome": "3", "end_position": "178936093", "exon": "10", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.E545D", "reference_allele": "G", "rsid": "rs121913275", "start_position": "178936093", "variant_annotation": "Missense" } ], "feature_id": 465, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 466, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1634A>G", "chromosome": "3", "end_position": "178936092", "exon": "10", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.E545G", "reference_allele": "A", "rsid": "rs121913274", "start_position": "178936092", "variant_annotation": "Missense" } ], "feature_id": 466, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 467, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.1633G>A", "chromosome": "3", "end_position": "178936091", "exon": "10", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.E545K", "reference_allele": "G", "rsid": "rs104886003", "start_position": "178936091", "variant_annotation": "Missense" } ], "feature_id": 467, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 468, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.3145G>C", "chromosome": "3", "end_position": "178952090", "exon": "21", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.G1049R", "reference_allele": "G", "rsid": "rs121913277", "start_position": "178952090", "variant_annotation": "Missense" } ], "feature_id": 468, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 469, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.3145G>A", "chromosome": "3", "end_position": "178952090", "exon": "21", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.G1049S", "reference_allele": "G", "rsid": "rs121913277", "start_position": "178952090", "variant_annotation": "Missense" } ], "feature_id": 469, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 470, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.3140A>T", "chromosome": "3", "end_position": "178952085", "exon": "21", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.H1047L", "reference_allele": "A", "rsid": "rs121913279", "start_position": "178952085", "variant_annotation": "Missense" } ], "feature_id": 470, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 471, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.3140A>G", "chromosome": "3", "end_position": "178952085", "exon": "21", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.H1047R", "reference_allele": "A", "rsid": "rs121913279", "start_position": "178952085", "variant_annotation": "Missense" } ], "feature_id": 471, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 472, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.3139C>T", "chromosome": "3", "end_position": "178952084", "exon": "21", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.H1047Y", "reference_allele": "C", "rsid": "rs121913281", "start_position": "178952084", "variant_annotation": "Missense" } ], "feature_id": 472, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 473, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.2102A>C", "chromosome": "3", "end_position": "178938860", "exon": "14", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.H701P", "reference_allele": "A", "rsid": "rs121913282", "start_position": "178938860", "variant_annotation": "Missense" } ], "feature_id": 473, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 474, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.3129G>A", "chromosome": "3", "end_position": "178952074", "exon": "21", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.M1043I", "reference_allele": "G", "rsid": "rs121913283", "start_position": "178952074", "variant_annotation": "Missense" } ], "feature_id": 474, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 475, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.3129G>A", "chromosome": "3", "end_position": "178952074", "exon": "21", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.M1043I", "reference_allele": "G", "rsid": "rs121913283", "start_position": "178952074", "variant_annotation": "Missense" } ], "feature_id": 475, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 476, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1616C>G", "chromosome": "3", "end_position": "178936074", "exon": "10", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.P539R", "reference_allele": "C", "rsid": "rs121913285", "start_position": "178936074", "variant_annotation": "Missense" } ], "feature_id": 476, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 477, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.1636C>A", "chromosome": "3", "end_position": "178936094", "exon": "10", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.Q546K", "reference_allele": "C", "rsid": "rs121913286", "start_position": "178936094", "variant_annotation": "Missense" } ], "feature_id": 477, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 478, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In vivo models harboring PIK3CA variants were especially sensitive to GDC-0941.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.3062A>G", "chromosome": "3", "end_position": "178952007", "exon": "21", "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": "p.Y1021C", "reference_allele": "A", "rsid": "rs121913288", "start_position": "178952007", "variant_annotation": "Missense" } ], "feature_id": 478, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "O'Brien C, Wallin JJ, Sampath D, et al. Predictive biomarkers of sensitivity to the phosphatidylinositol 3' kinase inhibitor GDC-0941 in breast cancer preclinical models. Clin Cancer Res. 2010;16(14):3670-83.", "doi": "10.1158/1078-0432.CCR-09-2828", "nct": "", "pmid": 20453058, "source_id": 60, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-09-2828" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 479, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A study of 529 patients with hereditary CRC were found to have an increased susceptibility to brain tumors.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.946G>C", "chromosome": "19", "end_position": "50905974", "exon": "8", "feature_type": "somatic_variant", "gene": "POLD1", "protein_change": "p.D316H", "reference_allele": "G", "rsid": "rs746087148", "start_position": "50905974", "variant_annotation": "Missense" } ], "feature_id": 479, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Bellido F, Pineda M, Aiza G, et al. POLE and POLD1 mutations in 529 kindred with familial colorectal cancer and/or polyposis: review of reported cases and recommendations for genetic testing and surveillance. Genet Med. 2016;18(4):325-32.", "doi": "10.1038/gim.2015.75", "nct": "", "pmid": 4823640, "source_id": 156, "source_type": "Journal", "url": "https://doi.org/10.1038/gim.2015.75" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 480, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A study of 529 patients with hereditary CRC were found to have an increased susceptibility to brain tumors.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.947A>G", "chromosome": "19", "end_position": "50905975", "exon": "8", "feature_type": "somatic_variant", "gene": "POLD1", "protein_change": "p.D316G", "reference_allele": "A", "rsid": "rs746087148", "start_position": "50905975", "variant_annotation": "Missense" } ], "feature_id": 480, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Bellido F, Pineda M, Aiza G, et al. POLE and POLD1 mutations in 529 kindred with familial colorectal cancer and/or polyposis: review of reported cases and recommendations for genetic testing and surveillance. Genet Med. 2016;18(4):325-32.", "doi": "10.1038/gim.2015.75", "nct": "", "pmid": 4823640, "source_id": 156, "source_type": "Journal", "url": "https://doi.org/10.1038/gim.2015.75" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 481, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A study of 529 patients with hereditary CRC were found to have an increased susceptibility to brain tumors.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1225C>T", "chromosome": "19", "end_position": "50906837", "exon": "10", "feature_type": "somatic_variant", "gene": "POLD1", "protein_change": "p.R409W", "reference_allele": "C", "rsid": "rs778135510", "start_position": "50906837", "variant_annotation": "Missense" } ], "feature_id": 481, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Bellido F, Pineda M, Aiza G, et al. POLE and POLD1 mutations in 529 kindred with familial colorectal cancer and/or polyposis: review of reported cases and recommendations for genetic testing and surveillance. Genet Med. 2016;18(4):325-32.", "doi": "10.1038/gim.2015.75", "nct": "", "pmid": 4823640, "source_id": 156, "source_type": "Journal", "url": "https://doi.org/10.1038/gim.2015.75" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 482, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A study of 529 patients with hereditary CRC were found to have an increased susceptibility to brain tumors.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1421T>C", "chromosome": "19", "end_position": "50909701", "exon": "12", "feature_type": "somatic_variant", "gene": "POLD1", "protein_change": "p.L474P", "reference_allele": "T", "rsid": "rs587777627", "start_position": "50909701", "variant_annotation": "Missense" } ], "feature_id": 482, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Bellido F, Pineda M, Aiza G, et al. POLE and POLD1 mutations in 529 kindred with familial colorectal cancer and/or polyposis: review of reported cases and recommendations for genetic testing and surveillance. Genet Med. 2016;18(4):325-32.", "doi": "10.1038/gim.2015.75", "nct": "", "pmid": 4823640, "source_id": 156, "source_type": "Journal", "url": "https://doi.org/10.1038/gim.2015.75" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 483, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Patients whose tumors contain DNA repair deficiencies may benefit from anti-PD-1 therapy. MMR deficient colorectal and noncolorectal cancer were enriched for partial response to Pembrolizumab in a cohort of 41 patients.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "19", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "POLD1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 483, "feature_type": "somatic_variant" } ], "last_updated": "2023-10-31", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Le DT, Uram JN, Wang H, et al. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency. N Engl J Med. 2015;372(26):2509-20.", "doi": "10.1056/NEJMoa1500596", "nct": "NCT01876511", "pmid": 26028255, "source_id": 147, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1500596" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 484, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutant tumors with somatic point mutations in POLE or POLD1 are being included along with MMR-deficient tumors in several ongoing ICB trials.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "19", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "POLD1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 484, "feature_type": "somatic_variant" } ], "last_updated": "2023-10-05", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Inferential", "sources": [ { "citation": "Mouw KW, Goldberg MS, Konstantinopoulos PA, D'Andrea AD. DNA Damage and Repair Biomarkers of Immunotherapy Response Cancer Discov. 2017; 7(7):675-693.", "doi": "10.1158/2159-8290.CD-17-0226", "nct": "", "pmid": 28630051, "source_id": 157, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-17-0226" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Durvalumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 485, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutant tumors with somatic point mutations in POLE or POLD1 are being included along with MMR-deficient tumors in several ongoing ICB trials.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "19", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "POLD1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 485, "feature_type": "somatic_variant" } ], "last_updated": "2023-10-05", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Inferential", "sources": [ { "citation": "Mouw KW, Goldberg MS, Konstantinopoulos PA, D'Andrea AD. DNA Damage and Repair Biomarkers of Immunotherapy Response Cancer Discov. 2017; 7(7):675-693.", "doi": "10.1158/2159-8290.CD-17-0226", "nct": "", "pmid": 28630051, "source_id": 157, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-17-0226" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 486, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A study of 529 patients with hereditary CRC were found to have an increased susceptibility to brain tumors.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1270C>G", "chromosome": "12", "end_position": "133250250", "exon": "13", "feature_type": "somatic_variant", "gene": "POLE", "protein_change": "p.L424V", "reference_allele": "G", "rsid": "rs483352909", "start_position": "133250250", "variant_annotation": "Missense" } ], "feature_id": 486, "feature_type": "somatic_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Bellido F, Pineda M, Aiza G, et al. POLE and POLD1 mutations in 529 kindred with familial colorectal cancer and/or polyposis: review of reported cases and recommendations for genetic testing and surveillance. Genet Med. 2016;18(4):325-32.", "doi": "10.1038/gim.2015.75", "nct": "", "pmid": 4823640, "source_id": 156, "source_type": "Journal", "url": "https://doi.org/10.1038/gim.2015.75" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 487, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Patients whose tumors contain DNA repair deficiencies may benefit from anti-PD-1 therapy. MMR deficient colorectal and noncolorectal cancer were enriched for partial response to Pembrolizumab in a cohort of 41 patients.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "POLE", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 487, "feature_type": "somatic_variant" } ], "last_updated": "2023-10-31", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Le DT, Uram JN, Wang H, et al. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency. N Engl J Med. 2015;372(26):2509-20.", "doi": "10.1056/NEJMoa1500596", "nct": "NCT01876511", "pmid": 26028255, "source_id": 147, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1500596" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 488, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutant tumors with somatic point mutations in POLE or POLD1 are being included along with MMR-deficient tumors in several ongoing ICB trials.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "POLE", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 488, "feature_type": "somatic_variant" } ], "last_updated": "2023-10-05", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Inferential", "sources": [ { "citation": "Mouw KW, Goldberg MS, Konstantinopoulos PA, D'Andrea AD. DNA Damage and Repair Biomarkers of Immunotherapy Response Cancer Discov. 2017; 7(7):675-693.", "doi": "10.1158/2159-8290.CD-17-0226", "nct": "", "pmid": 28630051, "source_id": 157, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-17-0226" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Durvalumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 489, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutant tumors with somatic point mutations in POLE or POLD1 are being included along with MMR-deficient tumors in several ongoing ICB trials.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "12", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "POLE", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 489, "feature_type": "somatic_variant" } ], "last_updated": "2023-10-05", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Inferential", "sources": [ { "citation": "Mouw KW, Goldberg MS, Konstantinopoulos PA, D'Andrea AD. DNA Damage and Repair Biomarkers of Immunotherapy Response Cancer Discov. 2017; 7(7):675-693.", "doi": "10.1158/2159-8290.CD-17-0226", "nct": "", "pmid": 28630051, "source_id": 157, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-17-0226" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 490, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "AZ8186 showed pharmacodynamic modulation of p-Akt in PC3 PTEN-deficient prostate tumor bearing mice and showed complete inhibition of tumor growth in mouse PTEN-deficient PC3 prostate tumor xenograft models. The publication states that AZ8186 entered into phase 1 study.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PTEN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 490, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Barlaam B, Cosulich S, Degorce S, et al. Discovery of (R)-8-(1-(3,5-difluorophenylamino)ethyl)-N,N-dimethyl-2-morpholino-4-oxo-4H-chromene-6-carboxamide (AZD8186): a potent and selective inhibitor of PI3K-beta and PI3K-gamma for the treatment of PTEN-deficient cancers. J Med Chem. 2015;58(2):943-62.", "doi": "10.1021/jm501629p", "nct": "", "pmid": 25514658, "source_id": 158, "source_type": "Journal", "url": "https://doi.org/10.1021/jm501629p" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "PI3Kbeta Inhibitor AZD8186", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 491, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "AZ8186 showed pharmacodynamic modulation of p-Akt in PC3 PTEN-deficient prostate tumor bearing mice and showed complete inhibition of tumor growth in mouse PTEN-deficient PC3 prostate tumor xenograft models. The publication states that AZ8186 entered into phase 1 study.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PTEN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 491, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Barlaam B, Cosulich S, Degorce S, et al. Discovery of (R)-8-(1-(3,5-difluorophenylamino)ethyl)-N,N-dimethyl-2-morpholino-4-oxo-4H-chromene-6-carboxamide (AZD8186): a potent and selective inhibitor of PI3K-beta and PI3K-gamma for the treatment of PTEN-deficient cancers. J Med Chem. 2015;58(2):943-62.", "doi": "10.1021/jm501629p", "nct": "", "pmid": 25514658, "source_id": 158, "source_type": "Journal", "url": "https://doi.org/10.1021/jm501629p" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "PI3Kbeta Inhibitor AZD8186", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 492, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "AZ8186 showed pharmacodynamic modulation of p-Akt in PC3 PTEN-deficient prostate tumor bearing mice and showed complete inhibition of tumor growth in mouse PTEN-deficient PC3 prostate tumor xenograft models. The publication states that AZ8186 entered into phase 1 study.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PTEN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 492, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Barlaam B, Cosulich S, Degorce S, et al. Discovery of (R)-8-(1-(3,5-difluorophenylamino)ethyl)-N,N-dimethyl-2-morpholino-4-oxo-4H-chromene-6-carboxamide (AZD8186): a potent and selective inhibitor of PI3K-beta and PI3K-gamma for the treatment of PTEN-deficient cancers. J Med Chem. 2015;58(2):943-62.", "doi": "10.1021/jm501629p", "nct": "", "pmid": 25514658, "source_id": 158, "source_type": "Journal", "url": "https://doi.org/10.1021/jm501629p" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "PI3Kbeta Inhibitor AZD8186", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 493, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PTEN loss may predict resistance to immune checkpoint blockade", "disease": "Uterine Leiomyoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PTEN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 493, "feature_type": "somatic_variant" } ], "last_updated": "2019-03-07", "oncotree_code": "ULM", "oncotree_term": "Uterine Leiomyoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "George S, Miao D, Demetri GD, et al. Loss of PTEN Is Associated with Resistance to Anti-PD-1 Checkpoint Blockade Therapy in Metastatic Uterine Leiomyosarcoma. Immunity. 2017;46(2):197-204.", "doi": "10.1016/j.immuni.2017.02.001", "nct": "", "pmid": 28228279, "source_id": 159, "source_type": "Journal", "url": "https://doi.org/10.1016/j.immuni.2017.02.001" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 494, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PTEN loss may predict resistance to immune checkpoint blockade", "disease": "Uterine Leiomyoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PTEN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 494, "feature_type": "somatic_variant" } ], "last_updated": "2019-03-07", "oncotree_code": "ULM", "oncotree_term": "Uterine Leiomyoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "George S, Miao D, Demetri GD, et al. Loss of PTEN Is Associated with Resistance to Anti-PD-1 Checkpoint Blockade Therapy in Metastatic Uterine Leiomyosarcoma. Immunity. 2017;46(2):197-204.", "doi": "10.1016/j.immuni.2017.02.001", "nct": "", "pmid": 28228279, "source_id": 159, "source_type": "Journal", "url": "https://doi.org/10.1016/j.immuni.2017.02.001" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 495, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PTEN loss may predict resistance to immune checkpoint blockade", "disease": "Uterine Leiomyoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PTEN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 495, "feature_type": "somatic_variant" } ], "last_updated": "2019-03-07", "oncotree_code": "ULM", "oncotree_term": "Uterine Leiomyoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "George S, Miao D, Demetri GD, et al. Loss of PTEN Is Associated with Resistance to Anti-PD-1 Checkpoint Blockade Therapy in Metastatic Uterine Leiomyosarcoma. Immunity. 2017;46(2):197-204.", "doi": "10.1016/j.immuni.2017.02.001", "nct": "", "pmid": 28228279, "source_id": 159, "source_type": "Journal", "url": "https://doi.org/10.1016/j.immuni.2017.02.001" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 496, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Median PFS was longer in patients with normal PTEN, TP53, and PIK3CA status.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PTEN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 496, "feature_type": "somatic_variant" } ], "last_updated": "2019-01-29", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Hussain M, Daignault-newton S, Twardowski PW, et al. Targeting Androgen Receptor and DNA Repair in Metastatic Castration-Resistant Prostate Cancer: Results From NCI 9012. J Clin Oncol. 2018;36(10):991-999.", "doi": "10.1200/JCO.2017.75.7310", "nct": "NCT01576172", "pmid": 29261439, "source_id": 44, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2017.75.7310" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 497, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PTEN loss may predict resistance to immune checkpoint blockade", "disease": "Uterine Leiomyoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PTEN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 497, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-14", "oncotree_code": "ULM", "oncotree_term": "Uterine Leiomyoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Peng W, Chen JQ, Liu C, et al. Loss of PTEN Promotes Resistance to T Cell-Mediated Immunotherapy. Cancer Discov. 2016;6(2):202-16.", "doi": "10.1158/2159-8290.CD-15-0283", "nct": "", "pmid": 26645196, "source_id": 160, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-15-0283" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 498, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PTEN loss may predict resistance to immune checkpoint blockade", "disease": "Uterine Leiomyoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PTEN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 498, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-14", "oncotree_code": "ULM", "oncotree_term": "Uterine Leiomyoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Peng W, Chen JQ, Liu C, et al. Loss of PTEN Promotes Resistance to T Cell-Mediated Immunotherapy. Cancer Discov. 2016;6(2):202-16.", "doi": "10.1158/2159-8290.CD-15-0283", "nct": "", "pmid": 26645196, "source_id": 160, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-15-0283" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 499, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PTEN loss may predict resistance to immune checkpoint blockade", "disease": "Uterine Leiomyoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PTEN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 499, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-14", "oncotree_code": "ULM", "oncotree_term": "Uterine Leiomyoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Peng W, Chen JQ, Liu C, et al. Loss of PTEN Promotes Resistance to T Cell-Mediated Immunotherapy. Cancer Discov. 2016;6(2):202-16.", "doi": "10.1158/2159-8290.CD-15-0283", "nct": "", "pmid": 26645196, "source_id": 160, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-15-0283" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 500, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PTEN loss may predict resistance to immune checkpoint blockade", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PTEN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 500, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-14", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Peng W, Chen JQ, Liu C, et al. Loss of PTEN Promotes Resistance to T Cell-Mediated Immunotherapy. Cancer Discov. 2016;6(2):202-16.", "doi": "10.1158/2159-8290.CD-15-0283", "nct": "", "pmid": 26645196, "source_id": 160, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-15-0283" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 501, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights variants in PTPN11 as being associated with shorter overall survival in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PTPN11", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 501, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 502, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51B", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 502, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 503, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51C", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 503, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 504, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51C", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 504, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 505, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51C", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 505, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 506, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51C", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 506, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 507, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51C", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 507, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 508, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51C", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 508, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 509, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51C", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 509, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 510, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51D", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 510, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 511, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51D", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 511, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 512, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51D", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 512, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 513, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51D", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 513, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 514, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51D", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 514, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 515, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Somatic homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51D", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 515, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 516, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51D", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 516, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 517, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD54L", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 517, "feature_type": "somatic_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 518, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "RBM10 mutations were associated with better prognosis in a study of 109 microdissected pancreatic adenocarcinoma tumors. Note that all RBM10-mutant patients were found to have high-grade pT3 stage tumors.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RBM10", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 518, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Witkiewicz AK, Mcmillan EA, Balaji U, et al. Whole-exome sequencing of pancreatic cancer defines genetic diversity and therapeutic targets. Nat Commun. 2015;6:6744.", "doi": "10.1038/ncomms7744", "nct": "", "pmid": 25855536, "source_id": 54, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms7744" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 519, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Certain missesnse mutations may predict resistance to RET inhibitors", "disease": "Medullary Thyroid Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.2410G>A", "chromosome": "10", "end_position": "43614996", "exon": "14", "feature_type": "somatic_variant", "gene": "RET", "protein_change": "p.V804M", "reference_allele": "G", "rsid": "rs79658334", "start_position": "43614996", "variant_annotation": "Missense" } ], "feature_id": 519, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "THME", "oncotree_term": "Medullary Thyroid Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Subbiah V, Velcheti V, Tuch BB, et al. Selective RET kinase inhibition for patients with RET-altered cancers. Ann Oncol. 2018;29(8):1869-1876.", "doi": "10.1093/annonc/mdy137", "nct": "", "pmid": 29912274, "source_id": 161, "source_type": "Journal", "url": "https://doi.org/10.1093/annonc/mdy137" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selpercatinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "RET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 520, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Certain missesnse mutations may predict sensitivity to RET inhibitors", "disease": "Medullary Thyroid Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.2753T>C", "chromosome": "10", "end_position": "43617416", "exon": "16", "feature_type": "somatic_variant", "gene": "RET", "protein_change": "p.M918T", "reference_allele": "T", "rsid": "rs74799832", "start_position": "43617416", "variant_annotation": "Missense" } ], "feature_id": 520, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "THME", "oncotree_term": "Medullary Thyroid Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Subbiah V, Velcheti V, Tuch BB, et al. Selective RET kinase inhibition for patients with RET-altered cancers. Ann Oncol. 2018;29(8):1869-1876.", "doi": "10.1093/annonc/mdy137", "nct": "", "pmid": 29912274, "source_id": 161, "source_type": "Journal", "url": "https://doi.org/10.1093/annonc/mdy137" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selpercatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 521, "context": "Advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to selpercatinib for the treatment of adult and pediatric patients 2 years of age and older with advanced or metastatic medullary thyroid cancer (MTC) with a RET mutation, as detected by an FDA-approved test, who require systemic therapy.", "disease": "Medullary Thyroid Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RET", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 521, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "THME", "oncotree_term": "Medullary Thyroid Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Eli Lily and Company. Retevmo (selpercatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/213246s011s013lbl.pdf. Revised September 2024. Accessed October 2, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 162, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/213246s011s013lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selpercatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 522, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights RUNX1 nonsense and frameshift variants as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RUNX1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 522, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 523, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights RUNX1 nonsense and frameshift variants as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RUNX1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 523, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 524, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SETBP1 E858, T864, I865, D868, S869, and G870 missense variants as being associated with disease progression in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.2572G>A", "chromosome": "18", "end_position": "42531877", "exon": "4", "feature_type": "somatic_variant", "gene": "SETBP1", "protein_change": "p.E858K", "reference_allele": "G", "rsid": null, "start_position": "42531877", "variant_annotation": "Missense" } ], "feature_id": 524, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 525, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SETBP1 E858, T864, I865, D868, S869, and G870 missense variants as being associated with disease progression in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2591C>T", "chromosome": "18", "end_position": "42531896", "exon": "4", "feature_type": "somatic_variant", "gene": "SETBP1", "protein_change": "p.T864M", "reference_allele": "C", "rsid": null, "start_position": "42531896", "variant_annotation": "Missense" } ], "feature_id": 525, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 526, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SETBP1 E858, T864, I865, D868, S869, and G870 missense variants as being associated with disease progression in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.2594T>A", "chromosome": "18", "end_position": "42531899", "exon": "4", "feature_type": "somatic_variant", "gene": "SETBP1", "protein_change": "p.I865N", "reference_allele": "T", "rsid": null, "start_position": "42531899", "variant_annotation": "Missense" } ], "feature_id": 526, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 527, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SETBP1 E858, T864, I865, D868, S869, and G870 missense variants as being associated with disease progression in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.2602G>A", "chromosome": "18", "end_position": "42531907", "exon": "4", "feature_type": "somatic_variant", "gene": "SETBP1", "protein_change": "p.D868N", "reference_allele": "G", "rsid": "rs267607042", "start_position": "42531907", "variant_annotation": "Missense" } ], "feature_id": 527, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 528, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SETBP1 E858, T864, I865, D868, S869, and G870 missense variants as being associated with disease progression in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2602G>T", "chromosome": "18", "end_position": "42531907", "exon": "4", "feature_type": "somatic_variant", "gene": "SETBP1", "protein_change": "p.D868Y", "reference_allele": "G", "rsid": "rs267607042", "start_position": "42531907", "variant_annotation": "Missense" } ], "feature_id": 528, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 529, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SETBP1 E858, T864, I865, D868, S869, and G870 missense variants as being associated with disease progression in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2605A>T", "chromosome": "18", "end_position": "42531910", "exon": "4", "feature_type": "somatic_variant", "gene": "SETBP1", "protein_change": "p.S869C", "reference_allele": "A", "rsid": null, "start_position": "42531910", "variant_annotation": "Missense" } ], "feature_id": 529, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 530, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SETBP1 E858, T864, I865, D868, S869, and G870 missense variants as being associated with disease progression in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.2608G>A", "chromosome": "18", "end_position": "42531913", "exon": "4", "feature_type": "somatic_variant", "gene": "SETBP1", "protein_change": "p.G870S", "reference_allele": "G", "rsid": "rs267607040", "start_position": "42531913", "variant_annotation": "Missense" } ], "feature_id": 530, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 531, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1864G>C", "chromosome": "2", "end_position": "198267493", "exon": "14", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.E622Q", "reference_allele": "C", "rsid": null, "start_position": "198267493", "variant_annotation": "Missense" } ], "feature_id": 531, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 532, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1866G>C", "chromosome": "2", "end_position": "198267491", "exon": "14", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.E622D", "reference_allele": "C", "rsid": "rs763149798", "start_position": "198267491", "variant_annotation": "Missense" } ], "feature_id": 532, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 533, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1868A>G", "chromosome": "2", "end_position": "198267489", "exon": "14", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.Y623C", "reference_allele": "T", "rsid": "rs1039242157", "start_position": "198267489", "variant_annotation": "Missense" } ], "feature_id": 533, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 534, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.1873C>T", "chromosome": "2", "end_position": "198267484", "exon": "14", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.R625C", "reference_allele": "G", "rsid": "rs775623976", "start_position": "198267484", "variant_annotation": "Missense" } ], "feature_id": 534, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 535, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1874G>A", "chromosome": "2", "end_position": "198267483", "exon": "14", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.R625H", "reference_allele": "C", "rsid": null, "start_position": "198267483", "variant_annotation": "Missense" } ], "feature_id": 535, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 536, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1876A>C", "chromosome": "2", "end_position": "198267481", "exon": "14", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.N626H", "reference_allele": "T", "rsid": "rs769888451", "start_position": "198267481", "variant_annotation": "Missense" } ], "feature_id": 536, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 537, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.1876A>T", "chromosome": "2", "end_position": "198267481", "exon": "14", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.N626Y", "reference_allele": "T", "rsid": "rs769888451", "start_position": "198267481", "variant_annotation": "Missense" } ], "feature_id": 537, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 538, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1876A>G", "chromosome": "2", "end_position": "198267481", "exon": "14", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.N626D", "reference_allele": "T", "rsid": "rs769888451", "start_position": "198267481", "variant_annotation": "Missense" } ], "feature_id": 538, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 539, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1985A>G", "chromosome": "2", "end_position": "198267372", "exon": "14", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.H662R", "reference_allele": "T", "rsid": null, "start_position": "198267372", "variant_annotation": "Missense" } ], "feature_id": 539, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 540, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1987A>C", "chromosome": "2", "end_position": "198267370", "exon": "14", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.T663P", "reference_allele": "T", "rsid": null, "start_position": "198267370", "variant_annotation": "Missense" } ], "feature_id": 540, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 541, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1998G>C", "chromosome": "2", "end_position": "198267359", "exon": "14", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.K666N", "reference_allele": "C", "rsid": null, "start_position": "198267359", "variant_annotation": "Missense" } ], "feature_id": 541, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 542, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1997A>C", "chromosome": "2", "end_position": "198267360", "exon": "14", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.K666T", "reference_allele": "T", "rsid": null, "start_position": "198267360", "variant_annotation": "Missense" } ], "feature_id": 542, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 543, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1996A>G", "chromosome": "2", "end_position": "198267361", "exon": "14", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.K666E", "reference_allele": "T", "rsid": "rs754688962", "start_position": "198267361", "variant_annotation": "Missense" } ], "feature_id": 543, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 544, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.2098A>G", "chromosome": "2", "end_position": "198266834", "exon": "15", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.K700E", "reference_allele": "T", "rsid": "rs559063155", "start_position": "198266834", "variant_annotation": "Missense" } ], "feature_id": 544, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 545, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.2111T>G", "chromosome": "2", "end_position": "198266821", "exon": "15", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.I704S", "reference_allele": "A", "rsid": "rs1574528840", "start_position": "198266821", "variant_annotation": "Missense" } ], "feature_id": 545, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 546, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2219G>A", "chromosome": "2", "end_position": "198266713", "exon": "15", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.G740E", "reference_allele": "C", "rsid": "rs776846119", "start_position": "198266713", "variant_annotation": "Missense" } ], "feature_id": 546, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 547, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.2219G>T", "chromosome": "2", "end_position": "198266713", "exon": "15", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.G740V", "reference_allele": "C", "rsid": "rs776846119", "start_position": "198266713", "variant_annotation": "Missense" } ], "feature_id": 547, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 548, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2225G>A", "chromosome": "2", "end_position": "198266611", "exon": "16", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.G742D", "reference_allele": "C", "rsid": "rs755415626", "start_position": "198266611", "variant_annotation": "Missense" } ], "feature_id": 548, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 549, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SF3B1 E622, Y623, R625, N626, H662, T663, K666, K700E, I704, G740, G742, and D781 missense variants as being associated with a favorable prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2343T>A", "chromosome": "2", "end_position": "198266493", "exon": "16", "feature_type": "somatic_variant", "gene": "SF3B1", "protein_change": "p.D781E", "reference_allele": "A", "rsid": null, "start_position": "198266493", "variant_annotation": "Missense" } ], "feature_id": 549, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 550, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "SMARCA4 inactivating mutations and sensitivity to AURKA inhibitor in preclinical models of non small cell lung adenocarcinoma", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "SMARCA4", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 550, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Preclinical", "sources": [ { "citation": "Tagal V, Wei S, Zhang W, et al. SMARCA4-inactivating mutations increase sensitivity to Aurora kinase A inhibitor VX-680 in non-small cell lung cancers. Nat Commun. 2017;8:14098.", "doi": "10.1038/ncomms14098", "nct": "", "pmid": 28102363, "source_id": 163, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms14098" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tozasertib Lactate", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Aurora kinase inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 551, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "SMARCA4 inactivating mutations and sensitivity to AURKA inhibitor in preclinical models of non small cell lung adenocarcinoma", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "SMARCA4", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 551, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Preclinical", "sources": [ { "citation": "Tagal V, Wei S, Zhang W, et al. SMARCA4-inactivating mutations increase sensitivity to Aurora kinase A inhibitor VX-680 in non-small cell lung cancers. Nat Commun. 2017;8:14098.", "doi": "10.1038/ncomms14098", "nct": "", "pmid": 28102363, "source_id": 163, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms14098" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tozasertib Lactate", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Aurora kinase inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 552, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "SMARCA4 inactivating mutations and sensitivity to AURKA inhibitor in preclinical models of non small cell lung adenocarcinoma", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "SMARCA4", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 552, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Preclinical", "sources": [ { "citation": "Tagal V, Wei S, Zhang W, et al. SMARCA4-inactivating mutations increase sensitivity to Aurora kinase A inhibitor VX-680 in non-small cell lung cancers. Nat Commun. 2017;8:14098.", "doi": "10.1038/ncomms14098", "nct": "", "pmid": 28102363, "source_id": 163, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms14098" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tozasertib Lactate", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Aurora kinase inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 553, "context": "de-novo metastatic castration sensitive", "created_on": "05/07/26", "deprecated": false, "description": "The presence of SPOP missense somatic variants was associated with improved survival outcomes in men with de novo metastatic castration-sensitive prostate cancer receiving standard androgen deprivation therapy.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "17", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "SPOP", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 553, "feature_type": "somatic_variant" } ], "last_updated": "2022-10-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Swami U, Isaacsson Velho P, Nussenzveig R, et al. Association of SPOP Mutations with Outcomes in Men with De Novo Metastatic Castration-sensitive Prostate Cancer. Eur Urol. 2020;78(5):652-656.", "doi": "10.1016/j.eururo.2020.06.033", "nct": "", "pmid": 32624276, "source_id": 164, "source_type": "Journal", "url": "https://doi.org/10.1016/j.eururo.2020.06.033" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen", "therapy_type": "Hormone therapy", "validated": true }, { "assertion_id": 554, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The presence of SPOP missense somatic variants was associated with improved response to abiraterone when considering 50% PSA falls, are less likely to progress, and are associated with longer median duration of abiraterone treatment.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "17", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "SPOP", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 554, "feature_type": "somatic_variant" } ], "last_updated": "2021-11-03", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Boysen G, Rodrigues DN, Rescigno P, et al. SPOP-Mutated/CHD1-Deleted Lethal Prostate Cancer and Abiraterone Sensitivity. Clin Cancer Res. 2018;24(22):5585-5593.", "doi": "", "nct": "", "pmid": 30068710, "source_id": 165, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-18-0937" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen", "therapy_type": "Hormone therapy", "validated": true }, { "assertion_id": 555, "context": "High-risk localized", "created_on": "05/07/26", "deprecated": false, "description": "The presence of SPOP missense somatic variants was associated with improved response to neoadjuvant anti-androgen therapy in high-risk localized prostate cancer.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "17", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "SPOP", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 555, "feature_type": "somatic_variant" } ], "last_updated": "2021-11-03", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Tewari AK, Cheung ATM, Crowdis J, et al. Molecular features of exceptional response to neoadjuvant anti-androgen therapy in high-risk localized prostate cancer. 2021;36(10)", "doi": "10.1016/j.celrep.2021.109665", "nct": "", "pmid": 34496240, "source_id": 166, "source_type": "Journal", "url": "https://doi.org/10.1016/j.celrep.2021.109665" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen", "therapy_type": "Hormone therapy", "validated": true }, { "assertion_id": 556, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights STAG2 nonsense, frameshift, and splice site variants as being associated with a poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "STAG2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 556, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 557, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights STAG2 nonsense, frameshift, and splice site variants as being associated with a poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "STAG2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 557, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 558, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights STAG2 nonsense, frameshift, and splice site variants as being associated with a poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "STAG2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 558, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 559, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "TET2 mutations are associated with an increased sensitivity to hypomethylating agents, such as AzaC. This study of 86 patients with MDS and AML observed a response rate of 86% in patients with mutated TET2 versus 45% in patients that were wild type, with a reported p-value of 0.007.", "disease": "Myelodysplasia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TET2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 559, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Itzykson R, Kosmider O, Cluzeau T, et al. Impact of TET2 mutations on response rate to azacitidine in myelodysplastic syndromes and low blast count acute myeloid leukemias. Leukemia. 2011;25(7):1147-1152", "doi": "10.1038/leu.2011.71", "nct": "", "pmid": 21494260, "source_id": 167, "source_type": "Journal", "url": "https://doi.org/10.1038/leu.2011.71" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Azacitidine", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Hypomethylating agent chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 560, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights TP53 nonsense, frameshift, splice site, and missense variants except for P47S and P72R as being associated with a poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TP53", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 560, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 561, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights TP53 nonsense, frameshift, splice site, and missense variants except for P47S and P72R as being associated with a poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TP53", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 561, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 562, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights TP53 nonsense, frameshift, splice site, and missense variants except for P47S and P72R as being associated with a poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TP53", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 562, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 563, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights TP53 nonsense, frameshift, splice site, and missense variants except for P47S and P72R as being associated with a poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TP53", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 563, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 564, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Lenalidomide (Revlimid) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with myelodysplastic syndromes and nonsense, frameshift, splice site, or missense variants in TP53 except for P47S and P72R. These mutations may predict resistance or relapse to lenalidomide.", "disease": "Myelodysplasia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TP53", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 564, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Lenalidomide", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Immunomodulation", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 565, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Lenalidomide (Revlimid) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with myelodysplastic syndromes and nonsense, frameshift, splice site, or missense variants in TP53 except for P47S and P72R. These mutations may predict resistance or relapse to lenalidomide.", "disease": "Myelodysplasia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TP53", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 565, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Lenalidomide", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Immunomodulation", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 566, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Lenalidomide (Revlimid) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with myelodysplastic syndromes and nonsense, frameshift, splice site, or missense variants in TP53 except for P47S and P72R. These mutations may predict resistance or relapse to lenalidomide.", "disease": "Myelodysplasia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TP53", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 566, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Lenalidomide", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Immunomodulation", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 567, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Lenalidomide (Revlimid) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with myelodysplastic syndromes and nonsense, frameshift, splice site, or missense variants in TP53 except for P47S and P72R. These mutations may predict resistance or relapse to lenalidomide.", "disease": "Myelodysplasia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TP53", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 567, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Lenalidomide", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Immunomodulation", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 568, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of mutant TP53 may suggest resistance to nutlin-3.", "disease": "Gastric Remnant Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TP53", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 568, "feature_type": "somatic_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "GRC", "oncotree_term": "Gastric Remnant Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Endo S, Yamato K, Hirai S, et al. Potent in vitro and in vivo antitumor effects of MDM2 inhibitor nutlin-3 in gastric cancer cells. Cancer Sci. 2011;102(3):605-13.", "doi": "10.1111/j.1349-7006.2010.01821.x", "nct": "", "pmid": 21205074, "source_id": 168, "source_type": "Journal", "url": "https://doi.org/10.1111/j.1349-7006.2010.01821.x" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "nutlin-3", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "MDM2-p53 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 569, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Median PFS was longer in patients with normal PTEN, TP53, and PIK3CA status.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TP53", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 569, "feature_type": "somatic_variant" } ], "last_updated": "2019-01-29", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Hussain M, Daignault-newton S, Twardowski PW, et al. Targeting Androgen Receptor and DNA Repair in Metastatic Castration-Resistant Prostate Cancer: Results From NCI 9012. J Clin Oncol. 2018;36(10):991-999.", "doi": "10.1200/JCO.2017.75.7310", "nct": "NCT01576172", "pmid": 29261439, "source_id": 44, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2017.75.7310" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 570, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In 17 rectal adenocarcinomas molecularly profiled pre- and post- chemoradiation, concurrent KRAS/TP53 mutations predicted non-responder status and worse PFS.", "disease": "Rectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TP53", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 570, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "READ", "oncotree_term": "Rectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Kamran SC, Lennerz JK, Margolis CA, et al. Integrative Molecular Characterization of Resistance to Neoadjuvant Chemoradiation in Rectal Cancer Clin Cancer Res. 2019;", "doi": "10.1158/1078-0432.CCR-19-0908", "nct": "", "pmid": 31253631, "source_id": 138, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-19-0908" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Chemoradiotherapy", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Chemotherapy + Radiation", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 571, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Everolimus is indicated for the treatment of subependymal giant cell astrocytoma (SEGA) associated with tuberous sclerosis complex in adults and pediatric patients who are not candidates for curative surgical resection", "disease": "Astrocytoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TSC1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 571, "feature_type": "somatic_variant" } ], "last_updated": "2023-10-05", "oncotree_code": "ASTR", "oncotree_term": "Astrocytoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Afinitor (everolimus) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/022334s044,203985s016lbl.pdf. Revised February 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 169, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/022334s044,203985s016lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 572, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function mutations in TSC1, TSC2, or FLCN may predict sensitivity to mTOR inhibition", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TSC1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 572, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-19", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Iyer G, Hanrahan AJ, Milowsky MI, et al. Genome sequencing identifies a basis for everolimus sensitivity. Science. 2012;338(6104):221.", "doi": "10.1126/science.1226344", "nct": "", "pmid": 22923433, "source_id": 110, "source_type": "Journal", "url": "https://doi.org/10.1126/science.1226344" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 573, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function mutations in TSC1, TSC2, or FLCN may predict sensitivity to mTOR inhibition", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TSC1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 573, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-19", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Iyer G, Hanrahan AJ, Milowsky MI, et al. Genome sequencing identifies a basis for everolimus sensitivity. Science. 2012;338(6104):221.", "doi": "10.1126/science.1226344", "nct": "", "pmid": 22923433, "source_id": 110, "source_type": "Journal", "url": "https://doi.org/10.1126/science.1226344" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 574, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function mutations in TSC1, TSC2, or FLCN may predict sensitivity to mTOR inhibition", "disease": "Anaplastic Thyroid Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TSC1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 574, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-19", "oncotree_code": "THAP", "oncotree_term": "Anaplastic Thyroid Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wagle N, Grabiner BC, Van allen EM, et al. Response and acquired resistance to everolimus in anaplastic thyroid cancer. N Engl J Med. 2014;371(15):1426-33.", "doi": "10.1056/NEJMoa1403352", "nct": "", "pmid": 25295501, "source_id": 111, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1403352" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 575, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function mutations in TSC1, TSC2, or FLCN may predict sensitivity to mTOR inhibition", "disease": "Anaplastic Thyroid Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TSC1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 575, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-19", "oncotree_code": "THAP", "oncotree_term": "Anaplastic Thyroid Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wagle N, Grabiner BC, Van allen EM, et al. Response and acquired resistance to everolimus in anaplastic thyroid cancer. N Engl J Med. 2014;371(15):1426-33.", "doi": "10.1056/NEJMoa1403352", "nct": "", "pmid": 25295501, "source_id": 111, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1403352" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 576, "context": "Advanced", "created_on": "05/07/26", "deprecated": false, "description": "In a study of 184 everolimus-treated patients with RCC from a phase 2 randomized trial, PFS neither differed on univariate analysis nor on multivariate testing based on variant status in TSC1, TSC2, or MTOR.", "disease": "Renal Clear Cell Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TSC1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 576, "feature_type": "somatic_variant" } ], "last_updated": "2019-08-12", "oncotree_code": "RCC", "oncotree_term": "Renal Clear Cell Carcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Voss MH, Chen D, Reising A, et al. PTEN Expression, Not Mutation Status in, or, Correlates with the Outcome on Everolimus in Patients with Renal Cell Carcinoma Treated on the Randomized RECORD-3 Trial. Clin Cancer Res. 2019;25(2):506-514.", "doi": "10.1158/1078-0432.CCR-18-1833", "nct": "NCT00903175", "pmid": 30327302, "source_id": 149, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-18-1833" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 577, "context": "Advanced", "created_on": "05/07/26", "deprecated": false, "description": "In a study of 184 everolimus-treated patients with RCC from a phase 2 randomized trial, PFS neither differed on univariate analysis nor on multivariate testing based on variant status in TSC1, TSC2, or MTOR.", "disease": "Renal Clear Cell Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TSC2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 577, "feature_type": "somatic_variant" } ], "last_updated": "2019-08-12", "oncotree_code": "RCC", "oncotree_term": "Renal Clear Cell Carcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Voss MH, Chen D, Reising A, et al. PTEN Expression, Not Mutation Status in, or, Correlates with the Outcome on Everolimus in Patients with Renal Cell Carcinoma Treated on the Randomized RECORD-3 Trial. Clin Cancer Res. 2019;25(2):506-514.", "doi": "10.1158/1078-0432.CCR-18-1833", "nct": "NCT00903175", "pmid": 30327302, "source_id": 149, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-18-1833" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 578, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Everolimus is indicated for the treatment of subependymal giant cell astrocytoma (SEGA) associated with tuberous sclerosis complex in adults and pediatric patients who are not candidates for curative surgical resection", "disease": "Astrocytoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TSC2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 578, "feature_type": "somatic_variant" } ], "last_updated": "2023-10-05", "oncotree_code": "ASTR", "oncotree_term": "Astrocytoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Afinitor (everolimus) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/022334s044,203985s016lbl.pdf. Revised February 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 169, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/022334s044,203985s016lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 579, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function mutations in TSC1, TSC2, or FLCN may predict sensitivity to mTOR inhibition", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TSC2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 579, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-19", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Iyer G, Hanrahan AJ, Milowsky MI, et al. Genome sequencing identifies a basis for everolimus sensitivity. Science. 2012;338(6104):221.", "doi": "10.1126/science.1226344", "nct": "", "pmid": 22923433, "source_id": 110, "source_type": "Journal", "url": "https://doi.org/10.1126/science.1226344" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 580, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function mutations in TSC1, TSC2, or FLCN may predict sensitivity to mTOR inhibition", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TSC2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 580, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-19", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Iyer G, Hanrahan AJ, Milowsky MI, et al. Genome sequencing identifies a basis for everolimus sensitivity. Science. 2012;338(6104):221.", "doi": "10.1126/science.1226344", "nct": "", "pmid": 22923433, "source_id": 110, "source_type": "Journal", "url": "https://doi.org/10.1126/science.1226344" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 581, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function mutations in TSC1, TSC2, or FLCN may predict sensitivity to mTOR inhibition", "disease": "Anaplastic Thyroid Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TSC2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 581, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-19", "oncotree_code": "THAP", "oncotree_term": "Anaplastic Thyroid Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wagle N, Grabiner BC, Van allen EM, et al. Response and acquired resistance to everolimus in anaplastic thyroid cancer. N Engl J Med. 2014;371(15):1426-33.", "doi": "10.1056/NEJMoa1403352", "nct": "", "pmid": 25295501, "source_id": 111, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1403352" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 582, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function mutations in TSC1, TSC2, or FLCN may predict sensitivity to mTOR inhibition", "disease": "Anaplastic Thyroid Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TSC2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 582, "feature_type": "somatic_variant" } ], "last_updated": "2018-09-19", "oncotree_code": "THAP", "oncotree_term": "Anaplastic Thyroid Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wagle N, Grabiner BC, Van allen EM, et al. Response and acquired resistance to everolimus in anaplastic thyroid cancer. N Engl J Med. 2014;371(15):1426-33.", "doi": "10.1056/NEJMoa1403352", "nct": "", "pmid": 25295501, "source_id": 111, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1403352" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 583, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights ZRSR2 nonsense and frameshift variants as being associated with a poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ZRSR2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 583, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 584, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights ZRSR2 nonsense and frameshift variants as being associated with a poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ZRSR2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 584, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 585, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Germline variants in ATM and other DNA repair genes have been described in patients experiencing extreme normal tissue toxicity from radiation.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "ATM", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 585, "feature_type": "germline_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Pollard JM, Gatti RA. Clinical Radiation Sensitivity With DNA Repair Disorders: An Overview International Journal of Radiation Oncology*Biology*Physics. 2009; 74(5):1323-1331.", "doi": "10.1016/j.ijrobp.2009.02.057", "nct": "", "pmid": 19616740, "source_id": 170, "source_type": "Journal", "url": "https://doi.org/10.1016/j.ijrobp.2009.02.057" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Radiation Therapy", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 586, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Pathogenic germline variants in ATM may increase risk of acquiring CRC. Germline pathogenic variants in ATM were enriched in several large cohorts of CRC patients when the frequency of multiple DNA-repair genes was compared to that of ancestry-matched healthy patients.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "ATM", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 586, "feature_type": "germline_variant" } ], "last_updated": "2019-04-16", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "AlDubayan SH, Giannakis M, Moore ND, et al. Inherited DNA-Repair Defects in Colorectal Cancer The American Journal of Human Genetics. 2018; 102(3):401-414.", "doi": "10.1016/j.ajhg.2018.01.018", "nct": "", "pmid": 29478780, "source_id": 171, "source_type": "Journal", "url": "https://doi.org/10.1016/j.ajhg.2018.01.018" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 587, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "SK-CO-1 cells are homozygous for ATM c.2251-10>T, lack ATM protein expression, and are sensitive to the PARP inhibitor olaparib.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2251-10T>G", "chromosome": "11", "end_position": "108128198", "exon": null, "feature_type": "germline_variant", "gene": "ATM", "pathogenic": "1", "protein_change": null, "reference_allele": "T", "rsid": "rs730881346", "start_position": "108128198", "variant_annotation": null } ], "feature_id": 587, "feature_type": "germline_variant" } ], "last_updated": "2019-08-15", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Wang C, Jette N, Moussienko D, Bebb DG, Lees-Miller SP. ATM-Deficient Colorectal Cancer Cells Are Sensitive to the PARP Inhibitor Olaparib Translational Oncology. 2017; 10(2):190-196.", "doi": "10.1016/j.tranon.2017.01.007", "nct": "", "pmid": 28182994, "source_id": 57, "source_type": "Journal", "url": "https://doi.org/10.1016/j.tranon.2017.01.007" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 588, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BARD1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 588, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 589, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BARD1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 589, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 590, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BARD1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 590, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 591, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BARD1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 591, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 592, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BARD1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 592, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 593, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BARD1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 593, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 594, "context": "Advanced, treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for niraparib for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status defined by either a deleterious or suspected deleterious BRCA mutation or genominc instability and who have progressed more than six months after response to the last platinum-based chemotherapy.", "disease": "Ovarian Epithelial Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 594, "feature_type": "germline_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "OVT", "oncotree_term": "Ovarian Epithelial Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline. Zejula (niraparib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 86, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 595, "context": "Treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for niraparib for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status defined by either a deleterious or suspected deleterious BRCA mutation or genominc instability and who have progressed more than six months after response to the last platinum-based chemotherapy.", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 595, "feature_type": "germline_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline. Zejula (niraparib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 86, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 596, "context": "Primary, treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for niraparib for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status defined by either a deleterious or suspected deleterious BRCA mutation or genominc instability and who have progressed more than six months after response to the last platinum-based chemotherapy.", "disease": "Peritoneal Serous Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 596, "feature_type": "germline_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "PSEC", "oncotree_term": "Peritoneal Serous Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline. Zejula (niraparib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 86, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 597, "context": "HER2-negative, metastatic, treated with chemotherapy in neoadjuvant, adjuvant, or metastatic setting", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for the treatment of patients with deleterious or suspected deleterious germline BRCA-mutated (gBRCAm), HER2-negative metastatic breast cancer who have been treated with chemotherapy either in the neoadjuvant, adjuvant, or metastatic setting. Patients with hormone receptor (HR)-positive breast cancer should have been treated with a prior endocrine therapy or be considered inappropriate for endorcrine therapy.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 597, "feature_type": "germline_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf. Revised May 2023. Accessed July 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 172, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 598, "context": "Advanced, treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for olaparib for the maintenance treatment of adult patients with deleterious or suspected deleterious germline or somatic BRCA-mutated advanced epithelial ovarian, fallopian tube or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy.", "disease": "Ovarian Epithelial Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 598, "feature_type": "germline_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "OVT", "oncotree_term": "Ovarian Epithelial Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12, 2020.", "doi": "", "nct": "NCT01844986", "pmid": "", "source_id": 81, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 599, "context": "Advanced, treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for olaparib for the maintenance treatment of adult patients with deleterious or suspected deleterious germline or somatic BRCA-mutated advanced epithelial ovarian, fallopian tube or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy.", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 599, "feature_type": "germline_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12, 2020.", "doi": "", "nct": "NCT01844986", "pmid": "", "source_id": 81, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 600, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for olaparib for the maintenance treatment of adult patients with deleterious or suspected deleterious germline or somatic BRCA-mutated advanced epithelial ovarian, fallopian tube or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy.", "disease": "Peritoneal Serous Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 600, "feature_type": "germline_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "PSEC", "oncotree_term": "Peritoneal Serous Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12, 2020.", "doi": "", "nct": "NCT01844986", "pmid": "", "source_id": 81, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 601, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Olaparib (Lynparza) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with chemotherapy-refractory ovarian cancer. These patients have higher response rates to PARP inhibitor therapy in the presence of BRCA1 and BRCA2 mutations, particularly concomittant with platinum-sensitive disease. Platinum-resistant disease partially abrogates olaparib sensitvity in the setting of BRCA1 and BRCA2 mutations.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 601, "feature_type": "germline_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Ovarian Cancer V.1.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 173, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/ovarian_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 602, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "When present alongside genomic instability, defined by a large number of structural variation events, the inactivation of DNA maintenance genes (BRCA1, BRCA2, PALB2) was associated with increased sensitivity to platinum therapy in pancreatic cancer patients.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 602, "feature_type": "germline_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Waddell N, Pajic M, Patch AM, et al. Whole genomes redefine the mutational landscape of pancreatic cancer. Nature. 2015;518(7540):495-501.", "doi": "10.1038/nature14169", "nct": "", "pmid": 25719666, "source_id": 85, "source_type": "Journal", "url": "https://doi.org/10.1038/nature14169" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 603, "context": "HER2-negative, recurrent or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Olaparib (Lynparza) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with recurrent or stage IV disease with HER2-negative tumors with germline BRCA1/2 variants.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 603, "feature_type": "germline_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Invasive Breast Cancer NCCN Evidence Blocks V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 10 2019]. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 174, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/breast_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 604, "context": "HER2-negative, recurrent or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Olaparib (Lynparza) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with recurrent or stage IV disease with HER2-negative tumors with germline BRCA1/2 variants", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 604, "feature_type": "germline_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Invasive Breast Cancer NCCN Evidence Blocks V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 10 2019]. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 174, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/breast_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 605, "context": "Triple-negative, recurrent or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Carboplatin is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with recurrent or stage IV disease with triple-negative tumors and germline BRCA 1/2 variants.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 605, "feature_type": "germline_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Invasive Breast Cancer NCCN Evidence Blocks V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 10 2019]. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 174, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/breast_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Carboplatin", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 606, "context": "Triple-negative, recurrent or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Cisplatin is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with recurrent or stage IV disease with triple-negative tumors and germline BRCA 1/2 variants.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 606, "feature_type": "germline_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Invasive Breast Cancer NCCN Evidence Blocks V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 10 2019]. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 174, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/breast_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cisplatin", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 607, "context": "HER2-negative locally advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for talazoparib indicated for the treatment of adult patients with deleterious or suspected deleterious germline BRCA-mutated HER2-negative locally advanced or metastatic breast cancer.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 607, "feature_type": "germline_variant" } ], "last_updated": "2021-09-16", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Talzenna (talazoparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/211651s006lbl.pdf. Revised October 2020. Accessed September 16, 2021.", "doi": "", "nct": "NCT01945775", "pmid": "", "source_id": 175, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/211651s006lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 608, "context": "Advanced, treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for niraparib for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status defined by either a deleterious or suspected deleterious BRCA mutation or genominc instability and who have progressed more than six months after response to the last platinum-based chemotherapy.", "disease": "Ovarian Epithelial Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 608, "feature_type": "germline_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "OVT", "oncotree_term": "Ovarian Epithelial Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline. Zejula (niraparib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 86, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 609, "context": "Treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for niraparib for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status defined by either a deleterious or suspected deleterious BRCA mutation or genominc instability and who have progressed more than six months after response to the last platinum-based chemotherapy.", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 609, "feature_type": "germline_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline. Zejula (niraparib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 86, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 610, "context": "Primary, treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for niraparib for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status defined by either a deleterious or suspected deleterious BRCA mutation or genominc instability and who have progressed more than six months after response to the last platinum-based chemotherapy.", "disease": "Peritoneal Serous Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 610, "feature_type": "germline_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "PSEC", "oncotree_term": "Peritoneal Serous Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline. Zejula (niraparib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 86, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 611, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 611, "feature_type": "germline_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 612, "context": "HER2-negative, recurrent or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Olaparib (Lynparza) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with recurrent or stage IV disease that are also HER2-negative tumors with germline BRCA1/2 variants.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 612, "feature_type": "germline_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Invasive Breast Cancer NCCN Evidence Blocks V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 10 2019]. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 174, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/breast_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 613, "context": "HER2-negative, recurrent or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Talazoparib (Talzenna) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with recurrent or stage IV disease that are also HER2-negative tumors with germline BRCA1/2 variants.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 613, "feature_type": "germline_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Invasive Breast Cancer NCCN Evidence Blocks V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 10 2019]. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 174, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/breast_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 614, "context": "Triple-negative, recurrent or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Carboplatin is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with recurrent or stage IV disease with triple-negative tumors and germline BRCA 1/2 variants.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 614, "feature_type": "germline_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Invasive Breast Cancer NCCN Evidence Blocks V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 10 2019]. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 174, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/breast_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Carboplatin", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 615, "context": "Triple-negative, recurrent or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Cisplatin is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with recurrent or stage IV disease with triple-negative tumors and germline BRCA 1/2 variants.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 615, "feature_type": "germline_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Invasive Breast Cancer NCCN Evidence Blocks V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 10 2019]. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 174, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/breast_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cisplatin", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 616, "context": "HER2-negative locally advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for talazoparib indicated for the treatment of adult patients with deleterious or suspected deleterious germline BRCA-mutated HER2-negative locally advanced or metastatic breast cancer.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 616, "feature_type": "germline_variant" } ], "last_updated": "2021-09-16", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Talzenna (talazoparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/211651s006lbl.pdf. Revised October 2020. Accessed November 12, 2020.", "doi": "", "nct": "NCT01945775", "pmid": "", "source_id": 176, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/211651s006lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 617, "context": "HER2-negative, metastatic, treated with chemotherapy in neoadjuvant, adjuvant, or metastatic setting", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for the treatment of patients with deleterious or suspected deleterious germline BRCA-mutated (gBRCAm), HER2-negative metastatic breast cancer who have been treated with chemotherapy either in the neoadjuvant, adjuvant, or metastatic setting.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 617, "feature_type": "germline_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf. Revised May 2023. Accessed July 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 172, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 618, "context": "Advanced, treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for niraparib for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status defined by either a deleterious or suspected deleterious BRCA mutation or genominc instability and who have progressed more than six months after response to the last platinum-based chemotherapy.", "disease": "Ovarian Epithelial Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 618, "feature_type": "germline_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "OVT", "oncotree_term": "Ovarian Epithelial Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline. Zejula (niraparib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 86, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 619, "context": "Treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for niraparib for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status defined by either a deleterious or suspected deleterious BRCA mutation or genominc instability and who have progressed more than six months after response to the last platinum-based chemotherapy.", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 619, "feature_type": "germline_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline. Zejula (niraparib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 86, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 620, "context": "Primary, treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for niraparib for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status defined by either a deleterious or suspected deleterious BRCA mutation or genominc instability and who have progressed more than six months after response to the last platinum-based chemotherapy.", "disease": "Peritoneal Serous Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 620, "feature_type": "germline_variant" } ], "last_updated": "2020-10-15", "oncotree_code": "PSEC", "oncotree_term": "Peritoneal Serous Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline. Zejula (niraparib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 86, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208447s015s017lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 621, "context": "Advanced, treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for olaparib for the maintenance treatment of adult patients with deleterious or suspected deleterious germline or somatic BRCA-mutated advanced epithelial ovarian, fallopian tube or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy.", "disease": "Ovarian Epithelial Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 621, "feature_type": "germline_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "OVT", "oncotree_term": "Ovarian Epithelial Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12, 2020.", "doi": "", "nct": "NCT01844986", "pmid": "", "source_id": 177, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 622, "context": "Advanced, treated with three or more prior lines of chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for olaparib for the maintenance treatment of adult patients with deleterious or suspected deleterious germline or somatic BRCA-mutated advanced epithelial ovarian, fallopian tube or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy.", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 622, "feature_type": "germline_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12, 2020.", "doi": "", "nct": "NCT01844986", "pmid": "", "source_id": 177, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 623, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for olaparib for the maintenance treatment of adult patients with deleterious or suspected deleterious germline or somatic BRCA-mutated advanced epithelial ovarian, fallopian tube or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy.", "disease": "Peritoneal Serous Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 623, "feature_type": "germline_variant" } ], "last_updated": "2020-11-12", "oncotree_code": "PSEC", "oncotree_term": "Peritoneal Serous Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12, 2020.", "doi": "", "nct": "NCT01844986", "pmid": "", "source_id": 177, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 624, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Olaparib (Lynparza) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with chemotherapy-refractory ovarian cancer. These patients have higher response rates to PARP inhibitor therapy in the presence of BRCA1 and BRCA2 mutations, particularly concomittant with platinum-sensitive disease. Platinum-resistant disease partially abrogates olaparib sensitvity in the setting of BRCA1 and BRCA2 mutations.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 624, "feature_type": "germline_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Ovarian Cancer V.1.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 173, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/ovarian_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 625, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Patients with chemotherapy-refractory prostate cancer have higher response rates to PARP inhibitor therapy in the presence of DNA repair mutations, particularly concomittant with platinum-sensitive disease. Platinum-resistant disease partially abrogates olaparib sensitvity in the setting of BRCA1 and BRCA2 mutations.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 625, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Mateo J, Carreira S, Sandhu S, et al. DNA-Repair Defects and Olaparib in Metastatic Prostate Cancer. N Engl J Med. 2015;373(18):1697-708.", "doi": "10.1056/NEJMoa1506859", "nct": "NCT01682772", "pmid": 26510020, "source_id": 88, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1506859" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 626, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "When present alongside genomic instability, defined by a large number of structural variation events, the inactivation of DNA maintenance genes (BRCA1, BRCA2, PALB2) was associated with increased sensitivity to platinum therapy in pancreatic cancer patients.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 626, "feature_type": "germline_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Waddell N, Pajic M, Patch AM, et al. Whole genomes redefine the mutational landscape of pancreatic cancer. Nature. 2015;518(7540):495-501.", "doi": "10.1038/nature14169", "nct": "", "pmid": 25719666, "source_id": 85, "source_type": "Journal", "url": "https://doi.org/10.1038/nature14169" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 627, "context": "Metastatic castration resistant prostate cancer", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for adult patients with deleterious or suspected deleterous germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC), who have progressed following prior treatment with enzalutamide or abiraterone.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 627, "feature_type": "germline_variant" } ], "last_updated": "2020-10-22", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf. Revised May 2020. Accessed 22 October, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 58, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 628, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "CHEK1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 628, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 629, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "CHEK1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 629, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 630, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "CHEK1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 630, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 631, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "CHEK1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 631, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 632, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "CHEK1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 632, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 633, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "CHEK1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 633, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 634, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "CHEK2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 634, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 635, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "CHEK2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 635, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 636, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "CHEK2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 636, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 637, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "CHEK2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 637, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 638, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "CHEK2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 638, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 639, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "CHEK2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 639, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 640, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "CHEK2 variants may increase risk of acquiring testicular germ cells tumors. Germline pathogenic mutations in CHEK2 were enriched in both discovery and validation cohorts of European men with TGCTs, compared to the ExAC Non-Finnish Europeans cohort of healthy patients.", "disease": "Testicular Germ Cell Tumors", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "CHEK2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 640, "feature_type": "germline_variant" } ], "last_updated": "2019-04-16", "oncotree_code": "TGCT", "oncotree_term": "Testicular Germ Cell Tumors", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "AlDubayan SH, Pyle LC, Gamulin M, et al. Association of Inherited Pathogenic Variants in Checkpoint Kinase 2 ( ) With Susceptibility to Testicular Germ Cell Tumors JAMA Oncol. 2019; 5(4):514-.", "doi": "10.1001/jamaoncol.2018.6477", "nct": "", "pmid": 30676620, "source_id": 178, "source_type": "Journal", "url": "https://doi.org/10.1001/jamaoncol.2018.6477" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 641, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Patients with defects in DNA mismatch repair genes often have a favorable prognosis and a decreased likelihood of metastasis. These patients do not benefit from, and may be resistant to, 5-fluorouracil therapy.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "EPCAM", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 641, "feature_type": "germline_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 80, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 642, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutation may indicate increased susceptibility to early-onset colorectal cancer.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.94C>T", "chromosome": "19", "end_position": "18194272", "exon": "2", "feature_type": "germline_variant", "gene": "IL12RB1", "pathogenic": null, "protein_change": "p.Q32*", "reference_allele": "G", "rsid": "rs121434492", "start_position": "18194272", "variant_annotation": "Nonsense" } ], "feature_id": 642, "feature_type": "germline_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Chubb D, Broderick P, Dobbins SE, et al. Rare disruptive mutations and their contribution to the heritable risk of colorectal cancer. Nat Commun. 2016;7:11883.", "doi": "10.1038/ncomms11883", "nct": "", "pmid": 27329137, "source_id": 179, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms11883" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 643, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutation may indicate increased susceptibility to early-onset colorectal cancer.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.1624C>T", "chromosome": "19", "end_position": "18173082", "exon": "15", "feature_type": "germline_variant", "gene": "IL12RB1", "pathogenic": null, "protein_change": "p.Q542*", "reference_allele": "G", "rsid": "rs372833507", "start_position": "18173082", "variant_annotation": "Nonsense" } ], "feature_id": 643, "feature_type": "germline_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Chubb D, Broderick P, Dobbins SE, et al. Rare disruptive mutations and their contribution to the heritable risk of colorectal cancer. Nat Commun. 2016;7:11883.", "doi": "10.1038/ncomms11883", "nct": "", "pmid": 27329137, "source_id": 179, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms11883" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 644, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutation may indicate increased susceptibility to early-onset colorectal cancer.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.1719dup", "chromosome": "22", "end_position": "31672776", "exon": "15", "feature_type": "germline_variant", "gene": "LIMK2", "pathogenic": null, "protein_change": "p.G574Rfs*12", "reference_allele": "-", "rsid": "rs540206607", "start_position": "31672776", "variant_annotation": "Frameshift" } ], "feature_id": 644, "feature_type": "germline_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Chubb D, Broderick P, Dobbins SE, et al. Rare disruptive mutations and their contribution to the heritable risk of colorectal cancer. Nat Commun. 2016;7:11883.", "doi": "10.1038/ncomms11883", "nct": "", "pmid": 27329137, "source_id": 179, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms11883" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 645, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutation may indicate increased susceptibility to early-onset colorectal cancer.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.1742dup", "chromosome": "22", "end_position": "31672807", "exon": "15", "feature_type": "germline_variant", "gene": "LIMK2", "pathogenic": null, "protein_change": "p.C582Lfs*4", "reference_allele": "-", "rsid": null, "start_position": "31672807", "variant_annotation": "Frameshift" } ], "feature_id": 645, "feature_type": "germline_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Chubb D, Broderick P, Dobbins SE, et al. Rare disruptive mutations and their contribution to the heritable risk of colorectal cancer. Nat Commun. 2016;7:11883.", "doi": "10.1038/ncomms11883", "nct": "", "pmid": 27329137, "source_id": 179, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms11883" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 646, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutation may indicate increased susceptibility to early-onset colorectal cancer.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.2049_2050insA", "chromosome": "22", "end_position": "31673114", "exon": "15", "feature_type": "germline_variant", "gene": "LIMK2", "pathogenic": null, "protein_change": "p.G684Tfs*16", "reference_allele": "-", "rsid": null, "start_position": "31673114", "variant_annotation": "Frameshift" } ], "feature_id": 646, "feature_type": "germline_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Chubb D, Broderick P, Dobbins SE, et al. Rare disruptive mutations and their contribution to the heritable risk of colorectal cancer. Nat Commun. 2016;7:11883.", "doi": "10.1038/ncomms11883", "nct": "", "pmid": 27329137, "source_id": 179, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms11883" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 647, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Patients with defects in DNA mismatch repair genes often have a favorable prognosis and a decreased likelihood of metastasis. These patients do not benefit from, and may be resistant to, 5-fluorouracil therapy.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "MLH1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 647, "feature_type": "germline_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 80, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 648, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Patients with defects in DNA mismatch repair genes may have enhanced sensitivity to immune checkpoint blockade.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "MLH3", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 648, "feature_type": "germline_variant" } ], "last_updated": "2023-10-31", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Le DT, Uram JN, Wang H, et al. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency. N Engl J Med. 2015;372(26):2509-20.", "doi": "10.1056/NEJMoa1500596", "nct": "NCT01876511", "pmid": 26028255, "source_id": 147, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1500596" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 649, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutation may indicate increased susceptibility to early-onset colorectal cancer.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.1726C>T", "chromosome": "11", "end_position": "94180442", "exon": "15", "feature_type": "germline_variant", "gene": "MRE11", "pathogenic": null, "protein_change": "p.R576*", "reference_allele": "G", "rsid": "rs774277300", "start_position": "94180442", "variant_annotation": "Nonsense" } ], "feature_id": 649, "feature_type": "germline_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Chubb D, Broderick P, Dobbins SE, et al. Rare disruptive mutations and their contribution to the heritable risk of colorectal cancer. Nat Commun. 2016;7:11883.", "doi": "10.1038/ncomms11883", "nct": "", "pmid": 27329137, "source_id": 179, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms11883" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 650, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutation may indicate increased susceptibility to early-onset colorectal cancer.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "-", "cdna_change": "c.1066del", "chromosome": "11", "end_position": "94201011", "exon": "10", "feature_type": "germline_variant", "gene": "MRE11", "pathogenic": null, "protein_change": "p.H356Tfs*34", "reference_allele": "C", "rsid": null, "start_position": "94201010", "variant_annotation": "Frameshift" } ], "feature_id": 650, "feature_type": "germline_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Chubb D, Broderick P, Dobbins SE, et al. Rare disruptive mutations and their contribution to the heritable risk of colorectal cancer. Nat Commun. 2016;7:11883.", "doi": "10.1038/ncomms11883", "nct": "", "pmid": 27329137, "source_id": 179, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms11883" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 651, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutation may indicate increased susceptibility to early-onset colorectal cancer.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": "c.21-6_26del", "chromosome": "11", "end_position": "94224137", "exon": "3", "feature_type": "germline_variant", "gene": "MRE11", "pathogenic": null, "protein_change": "p.L7fs*18", "reference_allele": null, "rsid": "rs587780138", "start_position": "94224125", "variant_annotation": "Frameshift" } ], "feature_id": 651, "feature_type": "germline_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Chubb D, Broderick P, Dobbins SE, et al. Rare disruptive mutations and their contribution to the heritable risk of colorectal cancer. Nat Commun. 2016;7:11883.", "doi": "10.1038/ncomms11883", "nct": "", "pmid": 27329137, "source_id": 179, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms11883" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 652, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Patients with defects in DNA mismatch repair genes often have a favorable prognosis and a decreased likelihood of metastasis. These patients do not benefit from, and may be resistant to, 5-fluorouracil therapy.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "MSH2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 652, "feature_type": "germline_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 80, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 653, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Patients with defects in DNA mismatch repair genes may have enhanced sensitivity to immune checkpoint blockade.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "MSH2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 653, "feature_type": "germline_variant" } ], "last_updated": "2023-10-31", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Le DT, Uram JN, Wang H, et al. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency. N Engl J Med. 2015;372(26):2509-20.", "doi": "10.1056/NEJMoa1500596", "nct": "NCT01876511", "pmid": 26028255, "source_id": 147, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1500596" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 654, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Patients with defects in DNA mismatch repair genes often have a favorable prognosis and a decreased likelihood of metastasis. These patients do not benefit from, and may be resistant to, 5-fluorouracil therapy.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "MSH6", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 654, "feature_type": "germline_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 80, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 655, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Patients with defects in DNA mismatch repair genes may have enhanced sensitivity to immune checkpoint blockade.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "MSH6", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 655, "feature_type": "germline_variant" } ], "last_updated": "2023-10-31", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Le DT, Uram JN, Wang H, et al. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency. N Engl J Med. 2015;372(26):2509-20.", "doi": "10.1056/NEJMoa1500596", "nct": "NCT01876511", "pmid": 26028255, "source_id": 147, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1500596" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 656, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Germline variants in genes known to cause cancer syndromes, such as TP53, RB1, and NF1, can increase the risk of radiation-induced secondary malignancies.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "NF1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 656, "feature_type": "germline_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Kleinerman RA. Radiation-sensitive genetically susceptible pediatric sub-populations Pediatr Radiol. 2008; 39(S1):27-31.", "doi": "10.1007/s00247-008-1015-6", "nct": "", "pmid": 19083227, "source_id": 180, "source_type": "Journal", "url": "https://doi.org/10.1007/s00247-008-1015-6" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Radiation Therapy", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 657, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "PALB2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 657, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 658, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "PALB2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 658, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 659, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "PALB2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 659, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 660, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "PALB2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 660, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 661, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "PALB2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 661, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 662, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "PALB2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 662, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 663, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "When present alongside genomic instability, defined by a large number of structural variation events, the inactivation of DNA maintenance genes (BRCA1, BRCA2, PALB2) was associated with increased sensitivity to platinum therapy in pancreatic cancer patients.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "PALB2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 663, "feature_type": "germline_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Waddell N, Pajic M, Patch AM, et al. Whole genomes redefine the mutational landscape of pancreatic cancer. Nature. 2015;518(7540):495-501.", "doi": "10.1038/nature14169", "nct": "", "pmid": 25719666, "source_id": 85, "source_type": "Journal", "url": "https://doi.org/10.1038/nature14169" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 664, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Pathogenic germline variants in PALB2 may increase risk of acquiring CRC. Germline pathogenic variants in PALB2 were enriched in several large cohorts of CRC patients when the frequency of multiple DNA-repair genes was compared to that of ancestry-matched healthy patients.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "PALB2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 664, "feature_type": "germline_variant" } ], "last_updated": "2019-04-16", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "AlDubayan SH, Giannakis M, Moore ND, et al. Inherited DNA-Repair Defects in Colorectal Cancer The American Journal of Human Genetics. 2018; 102(3):401-414.", "doi": "10.1016/j.ajhg.2018.01.018", "nct": "", "pmid": 29478780, "source_id": 171, "source_type": "Journal", "url": "https://doi.org/10.1016/j.ajhg.2018.01.018" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 665, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Patients with defects in DNA mismatch repair genes often have a favorable prognosis and a decreased likelihood of metastasis. These patients do not benefit from, and may be resistant to, 5-fluorouracil therapy.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "PMS2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 665, "feature_type": "germline_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 80, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 666, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutation may indicate increased susceptibility to early-onset colorectal cancer.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.1406dup", "chromosome": "14", "end_position": "50117073", "exon": "17", "feature_type": "germline_variant", "gene": "POLE2", "pathogenic": null, "protein_change": "p.L469Ffs*17", "reference_allele": "-", "rsid": "rs776517397", "start_position": "50117073", "variant_annotation": "Frameshift" } ], "feature_id": 666, "feature_type": "germline_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Chubb D, Broderick P, Dobbins SE, et al. Rare disruptive mutations and their contribution to the heritable risk of colorectal cancer. Nat Commun. 2016;7:11883.", "doi": "10.1038/ncomms11883", "nct": "", "pmid": 27329137, "source_id": 179, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms11883" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 667, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutation may indicate increased susceptibility to early-onset colorectal cancer.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1851_1852del", "chromosome": "7", "end_position": "124464070", "exon": "19", "feature_type": "germline_variant", "gene": "POT1", "pathogenic": null, "protein_change": "p.D617Efs*9", "reference_allele": "TTA", "rsid": "rs758673417", "start_position": "124464068", "variant_annotation": "Frameshift" } ], "feature_id": 667, "feature_type": "germline_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Chubb D, Broderick P, Dobbins SE, et al. Rare disruptive mutations and their contribution to the heritable risk of colorectal cancer. Nat Commun. 2016;7:11883.", "doi": "10.1038/ncomms11883", "nct": "", "pmid": 27329137, "source_id": 179, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms11883" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 668, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutation may indicate increased susceptibility to early-onset colorectal cancer.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.1087C>T", "chromosome": "7", "end_position": "124482937", "exon": "13", "feature_type": "germline_variant", "gene": "POT1", "pathogenic": null, "protein_change": "p.R363*", "reference_allele": "G", "rsid": "rs756198077", "start_position": "124482937", "variant_annotation": "Nonsense" } ], "feature_id": 668, "feature_type": "germline_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Chubb D, Broderick P, Dobbins SE, et al. Rare disruptive mutations and their contribution to the heritable risk of colorectal cancer. Nat Commun. 2016;7:11883.", "doi": "10.1038/ncomms11883", "nct": "", "pmid": 27329137, "source_id": 179, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms11883" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 669, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Mutation may indicate increased susceptibility to early-onset colorectal cancer.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.224dup", "chromosome": "7", "end_position": "124511000", "exon": "7", "feature_type": "germline_variant", "gene": "POT1", "pathogenic": null, "protein_change": "p.N75Kfs*16", "reference_allele": "-", "rsid": null, "start_position": "124511000", "variant_annotation": "Frameshift" } ], "feature_id": 669, "feature_type": "germline_variant" } ], "last_updated": "2019-06-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Chubb D, Broderick P, Dobbins SE, et al. Rare disruptive mutations and their contribution to the heritable risk of colorectal cancer. Nat Commun. 2016;7:11883.", "doi": "10.1038/ncomms11883", "nct": "", "pmid": 27329137, "source_id": 179, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms11883" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 670, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "RAD51C", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 670, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 671, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "RAD51C", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 671, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 672, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "RAD51C", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 672, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 673, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "RAD51C", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 673, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 674, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "RAD51C", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 674, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 675, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "RAD51C", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 675, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 676, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "RAD51D", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 676, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 677, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "RAD51D", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 677, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 678, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "RAD51D", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 678, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 679, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Peritoneal Mesothelioma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "RAD51D", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 679, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "PEMESO", "oncotree_term": "Peritoneal Mesothelioma", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 680, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "RAD51D", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 680, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 681, "context": "Primary", "created_on": "05/07/26", "deprecated": false, "description": "Germline homologous recombination mutations were predictive of platinum sensitivity compared with cases without homologous recombination mutations in Ovarian, Fallopian Tube, and Peritoneal Carcinomas. Mutant cases also had better overall survival than wild type.", "disease": "Serous Ovarian Cancer", "favorable_prognosis": 1, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "RAD51D", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 681, "feature_type": "germline_variant" } ], "last_updated": "2017-11-03", "oncotree_code": "SOC", "oncotree_term": "Serous Ovarian Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Pennington KP, Walsh T, Harrell MI, et al. Germline and somatic mutations in homologous recombination genes predict platinum response and survival in ovarian, fallopian tube, and peritoneal carcinomas. Clin Cancer Res. 2014;20(3):764-75.", "doi": "10.1158/1078-0432.CCR-13-2287", "nct": "", "pmid": 24240112, "source_id": 59, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-13-2287" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 682, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Germline variants in genes known to cause cancer syndromes, such as TP53, RB1, and NF1, can increase the risk of radiation-induced secondary malignancies.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "RB1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 682, "feature_type": "germline_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Kleinerman RA. Radiation-sensitive genetically susceptible pediatric sub-populations Pediatr Radiol. 2008; 39(S1):27-31.", "doi": "10.1007/s00247-008-1015-6", "nct": "", "pmid": 19083227, "source_id": 180, "source_type": "Journal", "url": "https://doi.org/10.1007/s00247-008-1015-6" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Radiation Therapy", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 683, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Germline variants in genes known to cause cancer syndromes, such as TP53, RB1, and NF1, can increase the risk of radiation-induced secondary malignancies.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "TP53", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 683, "feature_type": "germline_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Kleinerman RA. Radiation-sensitive genetically susceptible pediatric sub-populations Pediatr Radiol. 2008; 39(S1):27-31.", "doi": "10.1007/s00247-008-1015-6", "nct": "", "pmid": 19083227, "source_id": 180, "source_type": "Journal", "url": "https://doi.org/10.1007/s00247-008-1015-6" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Radiation Therapy", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 684, "context": "Castration Resistant Prostate Cancer", "created_on": "05/07/26", "deprecated": false, "description": "Abiraterone (Zytiga) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with castration-resistant prostate cancer. Androgen receptor activation is a potential mechanism of recurrence of prostate cancer during androgen deprivation therapy.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "AR" } ], "feature_id": 684, "feature_type": "copy_number" } ], "last_updated": "2023-11-02", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Prostate Cancer V.3.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 181, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/prostate_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Antiandrogen", "therapy_type": "Hormone therapy", "validated": true }, { "assertion_id": 685, "context": "Castration Resistant Prostate Cancer", "created_on": "05/07/26", "deprecated": false, "description": "Abiraterone (Zytiga) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with prostate cancer. Androgen receptor activation may predict sensitivity to second generation androgen deprivation or direct androgen inhibitors.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "AR" } ], "feature_id": 685, "feature_type": "copy_number" } ], "last_updated": "2023-11-02", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Prostate Cancer V.3.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 181, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/prostate_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen", "therapy_type": "Hormone therapy", "validated": true }, { "assertion_id": 686, "context": "Castration Resistant Prostate Cancer", "created_on": "05/07/26", "deprecated": false, "description": "Enzalutamide (Xtandi) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with prostate cancer. Androgen receptor activation may predict sensitivity to second generation androgen deprivation or direct androgen inhibitors.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "AR" } ], "feature_id": 686, "feature_type": "copy_number" } ], "last_updated": "2023-11-02", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Prostate Cancer V.3.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 181, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/prostate_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enzalutamide", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen", "therapy_type": "Hormone therapy", "validated": true }, { "assertion_id": 687, "context": "Triple-negative", "created_on": "05/07/26", "deprecated": false, "description": "In analysis of triple-negative breast cancer samples and cell lines, increased expression of androgen receptor was associated with increased risk of locoregional recurrence after RT. Radiation resistance in androgen receptor-postive, TNBC cell lines was reversed with enzalutamide.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "AR" } ], "feature_id": 687, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Speers C, Zhao SG, Chandler B, et al. Androgen receptor as a mediator and biomarker of radioresistance in triple-negative breast cancer npj Breast Cancer. 2017; 3(1).", "doi": "10.1038/s41523-017-0038-2", "nct": "", "pmid": 28840192, "source_id": 182, "source_type": "Journal", "url": "https://doi.org/10.1038/s41523-017-0038-2" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Radiation Therapy", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 688, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Loss of function ARID1A mutations may predict sensitivity to immune checkpoint blockade, particularly PD-L1 inhibition. Anti-PD-L1 antibody reduced tumor mutational burden and prolonged survival of mice ARID1A-deficient but not ARID1A-wild-type ovarian tumors.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "ARID1A" } ], "feature_id": 688, "feature_type": "copy_number" } ], "last_updated": "2019-02-04", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Preclinical", "sources": [ { "citation": "Shen J, Ju Z, Zhao W, et al. ARID1A deficiency promotes mutability and potentiates therapeutic antitumor immunity unleashed by immune checkpoint blockade. Nat Med. 2018;24(5):556-562.", "doi": "10.1038/s41591-018-0012-z", "nct": "", "pmid": 29736026, "source_id": 53, "source_type": "Journal", "url": "https://doi.org/10.1038/s41591-018-0012-z" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Durvalumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 689, "context": "Castration Resistant Prostate Cancer", "created_on": "05/07/26", "deprecated": false, "description": "Neuroendocrine prostate cancer (NEPC) cell lines shows enhanced sensitivity to pan-Aurora kinase inhibitor therapy, specifically to PHA-739358 (Danusertib).", "disease": "Prostate Neuroendocrine Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": "20q13.2", "direction": "Amplification", "feature_type": "copy_number", "gene": "AURKA" } ], "feature_id": 689, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "PRNE", "oncotree_term": "Prostate Neuroendocrine Cancer", "predictive_implication": "Preclinical", "sources": [ { "citation": "Beltran H, Rickman DS, Park K, et al. Molecular characterization of neuroendocrine prostate cancer and identification of new drug targets. Cancer Discov. 2011;1(6):487-95.", "doi": "10.1158/2159-8290.CD-11-0130", "nct": "", "pmid": 22389870, "source_id": 183, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-11-0130" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Danusertib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Aurora kinase inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 690, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Downmodulation of TPX2 and AURKA in the presence of 20q copy gain was shown to tumor growth", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": "20q13.2", "direction": "Amplification", "feature_type": "copy_number", "gene": "AURKA" } ], "feature_id": 690, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Sillars-Hardebol, Anke H., et al. TPX2 and AURKA promote 20q amplicon-driven colorectal adenoma to carcinoma progression. Gut 61.11 (2012): 1568-1575.", "doi": "10.1136/gutjnl-2011-301153", "nct": "", "pmid": 22207630, "source_id": 184, "source_type": "Journal", "url": "https://doi.org/10.1136/gutjnl-2011-301153" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 691, "context": "Advanced", "created_on": "05/07/26", "deprecated": false, "description": "MYC amplified small cell lung cancer", "disease": "Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "AURKB" } ], "feature_id": 691, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "SCLC", "oncotree_term": "Small Cell Lung Cancer", "predictive_implication": "Preclinical", "sources": [ { "citation": "Helfrich BA, Kim J, Gao D, et al. Barasertib (AZD1152), a Small Molecule Aurora B Inhibitor, Inhibits the Growth of SCLC Cell Lines In Vitro and In Vivo. Mol Cancer Ther. 2016;15(10):2314-2322.", "doi": "10.1158/1535-7163.MCT-16-0298", "nct": "", "pmid": 27496133, "source_id": 185, "source_type": "Journal", "url": "https://doi.org/10.1158/1535-7163.MCT-16-0298" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Barasertib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Aurora-B kinase inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 692, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "BRAF V600E mutant colorectal cancer cell lines were cultured in increasing concentrations of the MEK inhibitor AZD6244 (Selumetinib). FISH analysis marked increase in BRAF gene copies in resistant cells.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "BRAF" } ], "feature_id": 692, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Corcoran, Ryan B., et al. BRAF gene amplification can promote acquired resistance to MEK inhibitors in cancer cells harboring the BRAF V600E mutation. Science signaling 3.149 (2010): ra84.", "doi": "10.1126/scisignal.2001148", "nct": "", "pmid": 21098728, "source_id": 186, "source_type": "Journal", "url": "https://doi.org/10.1126/scisignal.2001148" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selumetinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 693, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Amplification of BRAF may predict resistance to RAF inhibition.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "BRAF" } ], "feature_id": 693, "feature_type": "copy_number" } ], "last_updated": "2019-06-13", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Wagle, Nikhil, et al. MAP kinase pathway alterations in BRAF-mutant melanoma patients with acquired resistance to combined RAF/MEK inhibition. Cancer discovery 4.1 (2014): 61-68.", "doi": "10.1158/2159-8290.CD-13-0631", "nct": "", "pmid": 24265154, "source_id": 78, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-13-0631" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vemurafenib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 694, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Patients with chemotherapy-refractory prostate cancer have higher response rates to PARP inhibitor therapy in the presence of DNA repair mutations, particularly concomittant with platinum-sensitive disease. Platinum-resistant disease partially abrogates olaparib sensitvity in the setting of BRCA1 and BRCA2 mutations.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "BRCA2" } ], "feature_id": 694, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Mateo J, Carreira S, Sandhu S, et al. DNA-Repair Defects and Olaparib in Metastatic Prostate Cancer. N Engl J Med. 2015;373(18):1697-708.", "doi": "10.1056/NEJMoa1506859", "nct": "NCT01682772", "pmid": 26510020, "source_id": 88, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1506859" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 695, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "CCND1 amplification showed reduced recurrence-free survival in a randomized control trial of postmenopausal breast cancer patients.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": "11p13", "direction": "Amplification", "feature_type": "copy_number", "gene": "CCND1" } ], "feature_id": 695, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Bostner, Josefine, et al. Amplification of CCND1 and PAK1 as predictors of recurrence and tamoxifen resistance in postmenopausal breast cancer. Oncogene 26.49 (2007): 6997-7005.", "doi": "10.1038/sj.onc.1210506", "nct": "", "pmid": 17486065, "source_id": 187, "source_type": "Journal", "url": "https://doi.org/10.1038/sj.onc.1210506" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 696, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "CCND1 amplification was observed in a study of 109 microdissected pancreatic adenocarcinoma tumors, and is predicted to have antitumor effects in response to palbociclib.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "CCND1" } ], "feature_id": 696, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Witkiewicz AK, Mcmillan EA, Balaji U, et al. Whole-exome sequencing of pancreatic cancer defines genetic diversity and therapeutic targets. Nat Commun. 2015;6:6744.", "doi": "10.1038/ncomms7744", "nct": "", "pmid": 25855536, "source_id": 54, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms7744" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Palbociclib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CDK4/6 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 697, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Sensitivity to Bortezomib was observed in ovarian cancer cell lines.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": "19q12", "direction": "Amplification", "feature_type": "copy_number", "gene": "CCNE1" } ], "feature_id": 697, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Preclinical", "sources": [ { "citation": "Etemadmoghadam, Dariush, et al. Synthetic lethality between CCNE1 amplification and loss of BRCA1. Proceedings of the National Academy of Sciences 110.48 (2013): 19489-19494.", "doi": "10.1073/pnas.1314302110", "nct": "", "pmid": 24218601, "source_id": 188, "source_type": "Journal", "url": "https://doi.org/10.1073/pnas.1314302110" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bortezomib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Proteasome inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 698, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PD-L1 expression in at least 50% of tumor cells correlated with improved efficacy of pembrolizumab in a trial of 495 patients with non-small cell lung cancer.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "CD274" } ], "feature_id": 698, "feature_type": "copy_number" } ], "last_updated": "2019-11-04", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Garon EB, Rizvi NA, Hui R, et al. Pembrolizumab for the treatment of non-small-cell lung cancer. N Engl J Med. 2015;372(21):2018-28.", "doi": "10.1056/NEJMoa1501824", "nct": "NCT01295827", "pmid": 25891174, "source_id": 189, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1501824" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 699, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) approved atezolizumab for the first-line treatment of adult patients with metastatic non-small cell lung cancer (NSCLC) whose tumors have high PD-L1 expression (PD-L1 staining >= 50% of tumor cells) or PD-L1 stained tumor-infiltrating immune cells covering >= 10% of the tumor area, with no EGFR or ALK genomic tumor aberrations.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "CD274" } ], "feature_id": 699, "feature_type": "copy_number" } ], "last_updated": "2020-11-12", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Genentech, Inc. Tecentriq (atezolizumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/761034s029lbl.pdf. Revised September 2020. Accessed October 22, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 190, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/761034s029lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Atezolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 700, "context": "Locally recurrent or metastatic triple-negative", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration granted accelerated approval to pembrolizumab in combination with chemotherapy for the treatment of patients with locally recurrent unresectable or metastatic triple-negative breast cancer (TNBC) whose tumors express PD-L1 (CPS>=10) as determined by an FDA approved test.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "CD274" } ], "feature_id": 700, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Merck Sharp & Dohme Corp. Keytruda (pembrolizumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/125514s088lbl.pdf. Revised November 2020. Accessed November 4, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 191, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/125514s088lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Chemotherapy + Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Chemotherapy + PD-1/PD-L1 inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 701, "context": "Recurrent locally advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration granted approval to pembrolizumab as a single agent for the treatment of patients with recurrent locally advanced or metastatic gastric adenocarcinoma whose tumors express PD-L1 as determined by an FDA-approved test.", "disease": "Stomach Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "CD274" } ], "feature_id": 701, "feature_type": "copy_number" } ], "last_updated": "2021-05-06", "oncotree_code": "STAD", "oncotree_term": "Stomach Adenocarcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Merck Sharp & Dohme Corp. Keytruda (pembrolizumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/125514s097lbl.pdf. Revised May 2021. Accessed May 6, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 192, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/125514s097lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 702, "context": "Recurrent locally advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration granted approval to pembrolizumab as a single agent for the treatment of patients with recurrent locally advanced or metastatic gastric adenocarcinoma whose tumors express PD-L1 as determined by an FDA-approved test.", "disease": "Adenocarcinoma of the Gastroesophageal Junction", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "CD274" } ], "feature_id": 702, "feature_type": "copy_number" } ], "last_updated": "2021-05-06", "oncotree_code": "GEJ", "oncotree_term": "Adenocarcinoma of the Gastroesophageal Junction", "predictive_implication": "Inferential", "sources": [ { "citation": "Merck Sharp & Dohme Corp. Keytruda (pembrolizumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/125514s097lbl.pdf. Revised May 2021. Accessed May 6, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 192, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/125514s097lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 703, "context": "Stage II to Stage IIIa", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to atezolizumab as adjuvant treatment for patients following resection and platinum-based chemotherapy for adult patients with stage II to IIIA NSCLC whose tumors have PD-L1 expression on >= 1% of tumor cells, as determined by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "CD274" } ], "feature_id": 703, "feature_type": "copy_number" } ], "last_updated": "2021-11-03", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Genentech, Inc. Tecentriq (atezolizumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/761034s042lbl.pdf. Revised October 2021. Accessed November 3, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 193, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/761034s042lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Atezolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 704, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Palbociclib (Ibrance) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with well-differentiated liposarcoma and CDK4 amplification. CDK4 amplification is characteristic of well-differentiated and dedifferentiated liposarcomas, and palbociclib shows activity in this context.", "disease": "Well-Differentiated Liposarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "CDK4" } ], "feature_id": 704, "feature_type": "copy_number" } ], "last_updated": "2023-11-02", "oncotree_code": "WDLS", "oncotree_term": "Well-Differentiated Liposarcoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Soft Tissue Sarcoma V.1.2021. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed November 19th, 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 194, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/sarcoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Palbociclib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CDK4/6 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 705, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Palbociclib (Ibrance) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with dedifferentiated liposarcoma and CDK4 amplification. CDK4 amplification is characteristic of well-differentiated and dedifferentiated liposarcomas, and palbociclib shows activity in this context.", "disease": "Dedifferentiated Lipsarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "CDK4" } ], "feature_id": 705, "feature_type": "copy_number" } ], "last_updated": "2023-11-02", "oncotree_code": "DDLS", "oncotree_term": "Dedifferentiated Lipsarcoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Soft Tissue Sarcoma V.1.2021. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed November 19th, 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 194, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/sarcoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Palbociclib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CDK4/6 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 706, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Treatment with CDK4 inhibitor PD033299 showed favorable progression free survival for patients with CDK4 amplification.", "disease": "Liposarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "CDK4" } ], "feature_id": 706, "feature_type": "copy_number" } ], "last_updated": "2019-01-29", "oncotree_code": "LIPO", "oncotree_term": "Liposarcoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Dickson, Mark A., et al. Phase II trial of the CDK4 inhibitor PD0332991 in patients with advanced CDK4-amplified well-differentiated or dedifferentiated liposarcoma. Journal of clinical oncology 31.16 (2013): 2024-2028.", "doi": "10.1200/JCO.2012.46.5476", "nct": "NCT01209598", "pmid": 23569312, "source_id": 195, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2012.46.5476" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Palbociclib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CDK4/6 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 707, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "CDK4 amplification was observed in a study of 109 microdissected pancreatic adenocarcinoma tumors, and is predicted to have antitumor effects in response to palbociclib.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "CDK4" } ], "feature_id": 707, "feature_type": "copy_number" } ], "last_updated": "2018-09-14", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Witkiewicz AK, Mcmillan EA, Balaji U, et al. Whole-exome sequencing of pancreatic cancer defines genetic diversity and therapeutic targets. Nat Commun. 2015;6:6744.", "doi": "10.1038/ncomms7744", "nct": "", "pmid": 25855536, "source_id": 54, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms7744" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Palbociclib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CDK4/6 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 708, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "These deletions are typically codeleted with MTAP, which has enhanced dependency on PRMT5 for which there is an inhibitor in clincial development", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "CDKN2A" } ], "feature_id": 708, "feature_type": "copy_number" } ], "last_updated": "2023-10-05", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Inferential", "sources": [ { "citation": "Kryukov GV, Wilson FH, Ruth JR, et al. MTAP deletion confers enhanced dependency on the PRMT5 arginine methyltransferase in cancer cells. Science. 2016;351(6278):1214-8.", "doi": "10.1126/science.aad5214", "nct": "", "pmid": 26912360, "source_id": 196, "source_type": "Journal", "url": "https://doi.org/10.1126/science.aad5214" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "EPZ015666", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PRMT5 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 709, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "CDKN2A loss was observed in a study of 109 microdissected pancreatic adenocarcinoma tumors, and is predicted to have antitumor effects in response to palbociclib.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "CDKN2A" } ], "feature_id": 709, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Witkiewicz AK, Mcmillan EA, Balaji U, et al. Whole-exome sequencing of pancreatic cancer defines genetic diversity and therapeutic targets. Nat Commun. 2015;6:6744.", "doi": "10.1038/ncomms7744", "nct": "", "pmid": 25855536, "source_id": 54, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms7744" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Palbociclib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CDK4/6 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 710, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Either hemizygous or homozygous CDKN2C loss, identified by FISH, resulted in worse overall survival relative to wild type in a study of 515 multiple myeloma patients.", "disease": "Multiple Myeloma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": "1p32.3", "direction": "Deletion", "feature_type": "copy_number", "gene": "CDKN2C" } ], "feature_id": 710, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "MM", "oncotree_term": "Multiple Myeloma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Leone, Paola E., et al. Deletions of CDKN2C in multiple myeloma: biological and clinical implications. Clinical Cancer Research 14.19 (2008): 6033-6041.", "doi": "10.1158/1078-0432.CCR-08-0347", "nct": "", "pmid": 18829482, "source_id": 197, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-08-0347" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 711, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Palbociclib is predicted to have antitumor effects in multiple myeloma patients with del(1p) resulting in loss of CDKN2C.", "disease": "Multiple Myeloma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": "1p", "direction": "Deletion", "feature_type": "copy_number", "gene": "CDKN2C" } ], "feature_id": 711, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "MM", "oncotree_term": "Multiple Myeloma", "predictive_implication": "Inferential", "sources": [ { "citation": "Manier S, Salem KZ, Park J, Landau DA, Getz G, Ghobrial IM. Genomic complexity of multiple myeloma and its clinical implications. Nat Rev Clin Oncol. 2017;14(2):100-113.", "doi": "10.1038/nrclinonc.2016.122", "nct": "", "pmid": 27531699, "source_id": 16, "source_type": "Journal", "url": "https://doi.org/10.1038/nrclinonc.2016.122" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Palbociclib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CDK4/6 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 712, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "CRKL amplification was observed in an EGFR inhibitor resistant tumor after researchers observed that cells from gefitinib-sensitive cell line (HCC827) overexpressing CRKL became resistant to gefitinib relative to controls.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": "22q11.21", "direction": "Amplification", "feature_type": "copy_number", "gene": "CRKL" } ], "feature_id": 712, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Cheung HW, Du J, Boehm JS, et al. Amplification of CRKL induces transformation and epidermal growth factor receptor inhibitor resistance in human non-small cell lung cancers. Cancer Discov. 2011;1(7):608-25.", "doi": "10.1158/2159-8290.CD-11-0046", "nct": "", "pmid": 22586683, "source_id": 198, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-11-0046" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Gefitinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 713, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Amplification and mutation of EGFR was associated with better clinical outcomes in a trial of 66 non-small cell lung cancer patients who had experienced relapse after surgery.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "EGFR" } ], "feature_id": 713, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Takano T, Ohe Y, Sakamoto H, et al. Epidermal growth factor receptor gene mutations and increased copy numbers predict gefitinib sensitivity in patients with recurrent non-small-cell lung cancer. J Clin Oncol. 2005;23(28):6829-37.", "doi": "10.1200/JCO.2005.01.0793", "nct": "", "pmid": 15998907, "source_id": 96, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2005.01.0793" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Gefitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 714, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The combination of lapatinib with trastuzumab provided a statistically significant improvement in PFS compared with single-agent lapatinib when tested for erbb2 positive breast cancer patients, both primary and metastatic.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 714, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Blackwell, Kimberly L., et al. Randomized study of Lapatinib alone or in combination with trastuzumab in women with ErbB2-positive, trastuzumab-refractory metastatic breast cancer. Journal of Clinical Oncology 28.7 (2010): 1124-1130.", "doi": "10.1200/JCO.2008.21.4437", "nct": "NCT00320385", "pmid": 20124187, "source_id": 199, "source_type": "Journal", "url": "https://doi.org/10.1200/JCO.2008.21.4437" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Lapatinib + Trastuzumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition + EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 715, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "HER2-targeted antibody and microtubule inhibitor conjugate indicated, as a single agent, for the treatment of patients with HER2-positive, metastatic breast cancer who previously received trastuzumab and a taxane, separately or in combination. Patients should have either: (1) Received prior therapy for metastatic disease, or (2) Developed disease recurrence during or within six months of completing adjuvant therapy.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 715, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Kadcyla (ado-trastuzumab emtansine) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/125427s108lbl.pdf. Revised September 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 200, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/125427s108lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Trastuzumab Emtansine", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition", "therapy_type": "Hormone therapy", "validated": true }, { "assertion_id": 716, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Lapatinib is a kinase inhibitor indicated in combination with: (1) capecitabine for the treatment of patients with advanced or metastatic breast cancer whose tumors overexpress human epidermal growth factor receptor 2 (HER2) and who have received prior therapy including an anthracycline, a taxane, and trastuzumab. Limitations of Use: Patients should have disease progression on trastuzumab prior to initiation of treatment with lapatinib in combination with capecitabine. (2) letrozole for the treatment of postmenopausal women with hormone receptorpositive metastatic breast cancer that overexpresses the HER2 receptor for whom hormonal therapy is indicated.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 716, "feature_type": "copy_number" } ], "last_updated": "2020-11-12", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Tykerb (lapatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/022059s024lbl.pdf. Revised December 2018. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 201, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/022059s024lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Lapatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition + EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 717, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Lapatinib is a kinase inhibitor indicated in combination with: (1) capecitabine for the treatment of patients with advanced or metastatic breast cancer whose tumors overexpress human epidermal growth factor receptor 2 (HER2) and who have received prior therapy including an anthracycline, a taxane, and trastuzumab. Limitations of Use: Patients should have disease progression on trastuzumab prior to initiation of treatment with lapatinib in combination with capecitabine. (2) letrozole for the treatment of postmenopausal women with hormone receptorpositive metastatic breast cancer that overexpresses the HER2 receptor for whom hormonal therapy is indicated.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 717, "feature_type": "copy_number" } ], "last_updated": "2020-11-12", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Tykerb (lapatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/022059s024lbl.pdf. Revised December 2018. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 201, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/022059s024lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Lapatinib + Trastuzumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition + EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 718, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) approved neratinib as a single agent for the extended adjuvant treatment of adult patients with early stage HER2-positive breast cancer, following adjuvant trastuzumab-based therapy.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 718, "feature_type": "copy_number" } ], "last_updated": "2024-01-11", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Puma Biotechnology, Inc. Nerlynx (neratinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/208051s009lbl.pdf. Revised June 2021. Accessed January 11, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 202, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/208051s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Neratinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 719, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to pertuzumab for use in combination with trastuzumab and docetaxel for treatment of patients with HER2-positive metastatic breast cancer (MBC) who have not received prior anti-HER2 therapy or chemotherapy for metastatic disease and use in combination with trastuzumab and chemotherapy as: (1) neoadjuvant treatment of patients with HER2-positive, locally advanced, inflammatory, or early stage breast cancer (either greater than 2 cm in diameter or node positive) as part of a complete treatment regimen for early breast cancer. (2) adjuvant treatment of patients with HER2-positive early breast cancer at high risk of recurrence", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 719, "feature_type": "copy_number" } ], "last_updated": "2023-10-05", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Perjeta (pertuzumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/125409s124lbl.pdf. Revised January 2020. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 203, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/125409s124lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pertuzumab + Trastuzumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 720, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to trastuzumab for use in the treatment of HER2-overexpressing breast cancer.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 720, "feature_type": "copy_number" } ], "last_updated": "2021-05-06", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Herceptin (trastuzumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/103792s5345lbl.pdf. Revised November 2018. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 204, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/103792s5345lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Trastuzumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 721, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to trastuzumab for use in the treatment of HER2-overexpressing metastatic gastric adenocarcinoma.", "disease": "Stomach Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 721, "feature_type": "copy_number" } ], "last_updated": "2021-05-06", "oncotree_code": "STAD", "oncotree_term": "Stomach Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Herceptin (trastuzumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/103792s5345lbl.pdf. Revised November 2018. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 204, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/103792s5345lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Trastuzumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 722, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to trastuzumab for use in the treatment of HER2-overexpressing metastatic gastroesophageal junction adenocarcinoma.", "disease": "Adenocarcinoma of the Gastroesophageal Junction", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 722, "feature_type": "copy_number" } ], "last_updated": "2021-05-06", "oncotree_code": "GEJ", "oncotree_term": "Adenocarcinoma of the Gastroesophageal Junction", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Herceptin (trastuzumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/103792s5345lbl.pdf. Revised November 2018. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 204, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/103792s5345lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Trastuzumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 723, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Trastuzumab (Herceptin) in combination with chemotherapy is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with metastatic gastric cancer and HER2 overexpression or amplification. These patients showed significant improvement in median overall survival with the addition of trastuzumab to chemotherapy compared to chemotherapy alone. This benefit is limited to patients with a tumor score of IHC 3 + or IHC 2 + and FISH positive.", "disease": "Stomach Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 723, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "STAD", "oncotree_term": "Stomach Adenocarcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Gastric Cancer V.3.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "NCT01041404", "pmid": 20728210, "source_id": 205, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/gastric_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Chemotherapy + Trastuzumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Chemotherapy + ER signaling inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 724, "context": "Advanced unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted regular approval for tucatinib, a kinase inhibitor indicated in combination with chemotherapy (trastuzumab and capecitabine) for treatment of adult patients with advanced unresectable or metastatic HER2-positive breast cancer, including patients with brain metastases, who have received one or more prior anti-HER2-based regimens in the metastatic setting.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 724, "feature_type": "copy_number" } ], "last_updated": "2020-11-12", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Seattle Genetics, Inc. Tukysa (tucatinib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2020/213411s000lbl.pdf. Revised April 2020. Accessed October 15, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 206, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/213411s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Capecitabine + Trastuzumab + Tucatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Thymidylate synthase inhibition + ER signaling inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 725, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Overexpression and gene amplification of ErbB2 (HER2/neu) is an adverse prognostic indicator associated with aggressive histopathologic parameters and correlated with decreased disease-free survival and overall survival (OS) in breast cancer (BC).", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 725, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "F Revillion, J Bonneterre, JP Peyrat: ERBB2 oncogene in human breast cancer and its clinical significance Eur J Cancer 34: 791", "doi": "10.1016/S0959-8049(97)10157-5", "nct": "", "pmid": 9797688, "source_id": 207, "source_type": "Journal", "url": "https://doi.org/10.1016/S0959-8049(97)10157-5" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 726, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Breast cancer cells with HER2 amplification demonstrate radiation resistance, which can be reversed with trastuzumab.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 726, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Liang K, Lu Y, Jin W, Ang KK, Milas L, Fan Z. Sensitization of breast cancer cells to radiation by trastuzumab. Molecular cancer therapeutics. 2003; 2(11):1113-20.", "doi": "", "nct": "", "pmid": 14617784, "source_id": 208, "source_type": "Journal", "url": "https://mct.aacrjournals.org/content/2/11/1113.long" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Radiation Therapy", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 727, "context": "Locally advanced, inflammatory, or early stage", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) approved a new fixed-dose combination of pertuzumab, trastuzumab, and hyaluronidase-zzxf for subcutaneous injection in combination with chemotherapy for the following indications: neoadjuvant treatment for patients with HER2-positive, locally advanced, inflammatory, or early stage breast cancer (either greater than 2 cm in diameter or node positive) as part of a complete treatment regimen for early breast cancer; adjuvant treatment for patients with HER2-positive early breast cancer at high risk of recurrence.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 727, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Phesgo (pertuzumab, trastuzumab, and hyaluronidase-zzxf) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/761170s000lbl.pdf. Revised June 2020. Accessed November 4, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 209, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/761170s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Chemotherapy + Hyaluronidase-zzxf + Pertuzumab + Trastuzumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Chemotherapy + ER signaling inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 728, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) approved a new fixed-dose combination of pertuzumab, trastuzumab, and hyaluronidase-zzxf for subcutaneous injection in combination with docetaxel for treatment of patients with HER-2 positive metastatic breast cancer (MBC) who have not received prior anti-HER2 therapy or chemotherapy for metastatic disease.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 728, "feature_type": "copy_number" } ], "last_updated": "2020-11-12", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Phesgo (pertuzumab, trastuzumab, and hyaluronidase-zzxf) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/761170s000lbl.pdf. Revised June 2020. Accessed November 4, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 209, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/761170s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Docetaxel + Hyaluronidase-zzxf + Pertuzumab + Trastuzumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Taxane-based chemotherapy + ER signaling inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 729, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) approved margetuximab-cmkb in combination with chemotherapy, for the treatment of adult patients with metastatic HER2-positive breast cancer who have received two or more prior anti-HER2 regimens, at least one of which was for metastatic disease.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 729, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "MacroGenics, Inc. Margenzat (margetuximab-cmkb) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/761150s000lbl.pdf. Revised December 2020. Accessed February 2, 2021.", "doi": "", "nct": "", "pmid": "", "source_id": 210, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/761150s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Chemotherapy + Margetuximab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition + Chemotherapy", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 730, "context": "Locally advanced unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to pembrolizumab in combination with trastuzumab, fluoropyrimidine- and platinum- containing chemotherapy for the first-line treatments of patients with locally advanced unresectable or metastatic HER2-positive gastric adenocarcinoma. In November 2023, the FDA updated this indication to restrict use to patients whose tumors express PD-L1 (CPS >= 1), as determined by an FDA-approved test.", "disease": "Stomach Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 730, "feature_type": "copy_number" } ], "last_updated": "2025-04-01", "oncotree_code": "STAD", "oncotree_term": "Stomach Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Merck Sharp & Dohme Corp. Keytruda (pembrolizumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/125514s174lbl.pdf. Revised April 2025. Accessed April 30, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 211, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/125514s174lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Fluoropyrimidine + Pembrolizumab + Platinum Compound + Trastuzumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antimetabolite + ER signaling inhibition + PD-1/PD-L1 inhibition + Chemotherapy", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 731, "context": "Locally advanced unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to pembrolizumab in combination with trastuzumab, fluoropyrimidine- and platinum- containing chemotherapy for the first-line treatments of patients with locally advanced unresectable or metastatic HER2-positive gastroesophageal junction adenocarcinoma. In November 2023, the FDA updated this indication to restrict use to patients whose tumors express PD-L1 (CPS >= 1), as determined by an FDA-approved test.", "disease": "Adenocarcinoma of the Gastroesophageal Junction", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 731, "feature_type": "copy_number" } ], "last_updated": "2025-04-01", "oncotree_code": "GEJ", "oncotree_term": "Adenocarcinoma of the Gastroesophageal Junction", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Merck Sharp & Dohme Corp. Keytruda (pembrolizumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/125514s170lbl.pdf. Revised March 2025. Accessed April 1, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 212, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/125514s170lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Fluoropyrimidine + Pembrolizumab + Platinum Compound + Trastuzumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antimetabolite + ER signaling inhibition + PD-1/PD-L1 inhibition + Chemotherapy", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 732, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Ampifications of ESR1 was significantly associated with poor disease-free survival and overall survival in a study of 99 patients with ER-positive breast cancer tumors.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ESR1" } ], "feature_id": 732, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Nielsen KV, Ejlertsen B, Muller S, et al. Amplification of ESR1 may predict resistance to adjuvant tamoxifen in postmenopausal patients with hormone receptor positive breast cancer. Breast Cancer Res Treat. 2011;127(2):345-55.", "doi": "10.1007/s10549-010-0984-y", "nct": "", "pmid": 20556506, "source_id": 213, "source_type": "Journal", "url": "https://doi.org/10.1007/s10549-010-0984-y" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 733, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Breast cancer tumor cell lines harboring deletions or mutations in FBXW7 are particularly sensitive to rapamycin treatment, FBXW7 may be a biomarker for human cancers susceptible to treatment with inhibitors of the mTOR pathway.", "disease": "Breast Invasive Ductal Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "FBXW7" } ], "feature_id": 733, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "IDC", "oncotree_term": "Breast Invasive Ductal Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Mao JH, Kim IJ, Wu D, et al. FBXW7 targets mTOR for degradation and cooperates with PTEN in tumor suppression. Science. 2008;321(5895):1499-502.", "doi": "10.1126/science.1162981", "nct": "", "pmid": 18787170, "source_id": 109, "source_type": "Journal", "url": "https://doi.org/10.1126/science.1162981" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Sirolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 734, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A study of 32 Cancer Cell Line Encyclopedia cell lines demonstrating FGFR1 and FGFR2 amplification demonstrated sensitivity to Infigratinib.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "FGFR1" } ], "feature_id": 734, "feature_type": "copy_number" } ], "last_updated": "2019-04-30", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Guagnano V, Kauffmann A, Wohrle S, et al. FGFR genetic alterations predict for sensitivity to NVP-BGJ398, a selective pan-FGFR inhibitor. Cancer Discov. 2012;2(12):1118-33.", "doi": "10.1158/2159-8290.CD-12-0210", "nct": "", "pmid": 23002168, "source_id": 214, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-12-0210" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Infigratinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 735, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A study of 32 Cancer Cell Line Encyclopedia cell lines demonstrating FGFR1 and FGFR2 amplification demonstrated sensitivity to Infigratinib.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "FGFR1" } ], "feature_id": 735, "feature_type": "copy_number" } ], "last_updated": "2019-04-30", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Preclinical", "sources": [ { "citation": "Guagnano V, Kauffmann A, Wohrle S, et al. FGFR genetic alterations predict for sensitivity to NVP-BGJ398, a selective pan-FGFR inhibitor. Cancer Discov. 2012;2(12):1118-33.", "doi": "10.1158/2159-8290.CD-12-0210", "nct": "", "pmid": 23002168, "source_id": 214, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-12-0210" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Infigratinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 736, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A study of 32 Cancer Cell Line Encyclopedia cell lines demonstrating FGFR1 and FGFR2 amplification demonstrated sensitivity to Infigratinib.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "FGFR1" } ], "feature_id": 736, "feature_type": "copy_number" } ], "last_updated": "2019-04-30", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Guagnano V, Kauffmann A, Wohrle S, et al. FGFR genetic alterations predict for sensitivity to NVP-BGJ398, a selective pan-FGFR inhibitor. Cancer Discov. 2012;2(12):1118-33.", "doi": "10.1158/2159-8290.CD-12-0210", "nct": "", "pmid": 23002168, "source_id": 214, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-12-0210" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Infigratinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 737, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A study of 32 Cancer Cell Line Encyclopedia cell lines demonstrating FGFR1 and FGFR2 amplification demonstrated sensitivity to Infigratinib.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "FGFR1" } ], "feature_id": 737, "feature_type": "copy_number" } ], "last_updated": "2019-04-30", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Guagnano V, Kauffmann A, Wohrle S, et al. FGFR genetic alterations predict for sensitivity to NVP-BGJ398, a selective pan-FGFR inhibitor. Cancer Discov. 2012;2(12):1118-33.", "doi": "10.1158/2159-8290.CD-12-0210", "nct": "", "pmid": 23002168, "source_id": 214, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-12-0210" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Infigratinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 738, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A study of 32 Cancer Cell Line Encyclopedia cell lines demonstrating FGFR1 and FGFR2 amplification demonstrated sensitivity to Infigratinib.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "FGFR2" } ], "feature_id": 738, "feature_type": "copy_number" } ], "last_updated": "2019-04-30", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Guagnano V, Kauffmann A, Wohrle S, et al. FGFR genetic alterations predict for sensitivity to NVP-BGJ398, a selective pan-FGFR inhibitor. Cancer Discov. 2012;2(12):1118-33.", "doi": "10.1158/2159-8290.CD-12-0210", "nct": "", "pmid": 23002168, "source_id": 214, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-12-0210" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Infigratinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 739, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A study of 32 Cancer Cell Line Encyclopedia cell lines demonstrating FGFR1 and FGFR2 amplification demonstrated sensitivity to Infigratinib.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "FGFR2" } ], "feature_id": 739, "feature_type": "copy_number" } ], "last_updated": "2019-04-30", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Preclinical", "sources": [ { "citation": "Guagnano V, Kauffmann A, Wohrle S, et al. FGFR genetic alterations predict for sensitivity to NVP-BGJ398, a selective pan-FGFR inhibitor. Cancer Discov. 2012;2(12):1118-33.", "doi": "10.1158/2159-8290.CD-12-0210", "nct": "", "pmid": 23002168, "source_id": 214, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-12-0210" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Infigratinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 740, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A study of 32 Cancer Cell Line Encyclopedia cell lines demonstrating FGFR1 and FGFR2 amplification demonstrated sensitivity to Infigratinib.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "FGFR2" } ], "feature_id": 740, "feature_type": "copy_number" } ], "last_updated": "2019-04-30", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Guagnano V, Kauffmann A, Wohrle S, et al. FGFR genetic alterations predict for sensitivity to NVP-BGJ398, a selective pan-FGFR inhibitor. Cancer Discov. 2012;2(12):1118-33.", "doi": "10.1158/2159-8290.CD-12-0210", "nct": "", "pmid": 23002168, "source_id": 214, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-12-0210" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Infigratinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 741, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A study of 32 Cancer Cell Line Encyclopedia cell lines demonstrating FGFR1 and FGFR2 amplification demonstrated sensitivity to Infigratinib.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "FGFR2" } ], "feature_id": 741, "feature_type": "copy_number" } ], "last_updated": "2019-04-30", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Guagnano V, Kauffmann A, Wohrle S, et al. FGFR genetic alterations predict for sensitivity to NVP-BGJ398, a selective pan-FGFR inhibitor. Cancer Discov. 2012;2(12):1118-33.", "doi": "10.1158/2159-8290.CD-12-0210", "nct": "", "pmid": 23002168, "source_id": 214, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-12-0210" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Infigratinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 742, "context": "Muscle-Invasive", "created_on": "05/07/26", "deprecated": false, "description": "In a retrospective study of 137 patients with high-grade invasive bladder cancer, patients with high HIF-1a expression had improved local relapse-free survival when receiving RT+CON compared with RT alone.", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "HIF1a" } ], "feature_id": 742, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Hunter BA, Eustace A, Irlam JJ, et al. Expression of hypoxia-inducible factor-1_ predicts benefit from hypoxia modification in invasive bladder cancer Br J Cancer. 2014; 111(3):437-443.", "doi": "10.1038/bjc.2014.315", "nct": "", "pmid": 24937673, "source_id": 215, "source_type": "Journal", "url": "https://doi.org/10.1038/bjc.2014.315" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Carbogen + Radiation Therapy", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 743, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In a mouse model of lung scamous cell carcinoma, deletion of KEAP1 promoted tumor aggressiveness, metastasis, and resistance to oxidative stress and radiotherapy (RT). KEAP1 / NRF2 mutation status predicted risk of local recurrence after RT in patients with non-small lung cancer (NSCLC).", "disease": "Lung Squamous Cell Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "KEAP1" } ], "feature_id": 743, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "LUSC", "oncotree_term": "Lung Squamous Cell Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Jeong Y, Hoang NT, Lovejoy A, et al. Role of / and Mutations in Lung Squamous Cell Carcinoma Development and Radiation Resistance Cancer Discov. 2017; 7(1):86-101.", "doi": "10.1158/2159-8290.cd-16-0127", "nct": "", "pmid": 27663899, "source_id": 216, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.cd-16-0127" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Radiation Therapy", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 744, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Imatinib (Gleevec) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with melanoma and amplification of KIT; KIT amplifications appear to have minimal or no sensitivity to KIT inhibitors.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "KIT" } ], "feature_id": 744, "feature_type": "copy_number" } ], "last_updated": "2023-11-02", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Cutaneous Melanoma V.2.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 126, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/cutaneous_melanoma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Imatinib", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "KIT inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 745, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Presence of amplified MDM2 may suggest sensitivity to nutlin-3 in the absense of mutant TP53.", "disease": "Gastric Remnant Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "MDM2" } ], "feature_id": 745, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "GRC", "oncotree_term": "Gastric Remnant Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Endo S, Yamato K, Hirai S, et al. Potent in vitro and in vivo antitumor effects of MDM2 inhibitor nutlin-3 in gastric cancer cells. Cancer Sci. 2011;102(3):605-13.", "doi": "10.1111/j.1349-7006.2010.01821.x", "nct": "", "pmid": 21205074, "source_id": 168, "source_type": "Journal", "url": "https://doi.org/10.1111/j.1349-7006.2010.01821.x" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "nutlin-3", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MDM2-p53 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 746, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Crizotinib (Xalkori) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with metastatic non-small cell lung cancer whose tumors harbor an amplification of MET.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "MET" } ], "feature_id": 746, "feature_type": "copy_number" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.5.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12, 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 11, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Crizotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 747, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Gefitinib (Iressa) is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with non-small cell lung cancer whose tumors harbor an amplification of MET, as amplification of alternative kinases, such as MET, may suggest resistance to EGFR TKIs.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "MET" } ], "feature_id": 747, "feature_type": "copy_number" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.1.2017. \u00a9 National Comprehensive Cancer Network, Inc. 2017. All rights reserved. Accessed November 5, 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 20, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Gefitinib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 748, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Results from the METEOR trial (n=658) suggest that the MET expression level might not affect treatment outcomes with cabozantinib in this patient population.", "disease": "Renal Clear Cell Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "MET" } ], "feature_id": 748, "feature_type": "copy_number" } ], "last_updated": "2019-08-12", "oncotree_code": "RCC", "oncotree_term": "Renal Clear Cell Carcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Choueiri TK, Escudier B, Powles T, et al. Cabozantinib versus Everolimus in Advanced Renal-Cell Carcinoma. N Engl J Med. 2015;373(19):1814-23.", "doi": "10.1056/NEJMoa1510016", "nct": "NCT01865747", "pmid": 26406150, "source_id": 217, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1510016" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cabozantinib", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "RET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 749, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "MET" } ], "feature_id": 749, "feature_type": "copy_number" } ], "last_updated": "2025-01-08", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical trial", "sources": [ { "citation": "A phase 1 trial of crizotinib (NCT00585195) in patients with MET amplified non-small cell lung cancer observed an objective response rate of 6 out of 15 patients with MET amplified gene copy number greater than or equal to 6. The study enrolled 38 patients with MET-to-CEP7 ratios greater than equal to 1.8 by local FISH testing.", "doi": "10.1016/j.jtho.2021.02.010", "nct": "", "pmid": 33676017, "source_id": 218, "source_type": "Journal", "url": "https://doi.org/10.1016/j.jtho.2021.02.010" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Crizotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 750, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Amplification of the 13q31-34 region, which contains MIR17HG, was associated with increased sensitivity to neoadjuvant chemotherapy and surgery in 41% of participants in a 120-patient study.", "disease": "Rectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "MIR17HG" } ], "feature_id": 750, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "READ", "oncotree_term": "Rectal Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Molinari C, Salvi S, Foca F, et al. miR-17-92a-1 cluster host gene (MIR17HG) evaluation and response to neoadjuvant chemoradiotherapy in rectal cancer. Onco Targets Ther. 2016;9:2735-42.", "doi": "10.2147/OTT.S105760", "nct": "", "pmid": 27226732, "source_id": 219, "source_type": "Journal", "url": "https://doi.org/10.2147/OTT.S105760" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Chemotherapy + Surgery", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Chemotherapy + Surgical removal", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 751, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Deletion of the 13q31-34 region, which contains MIR17HG, was associated with resistance to neoadjuvant chemotherapy and surgery in 41% of participants in a 120-patient study.", "disease": "Rectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "MIR17HG" } ], "feature_id": 751, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "READ", "oncotree_term": "Rectal Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Molinari C, Salvi S, Foca F, et al. miR-17-92a-1 cluster host gene (MIR17HG) evaluation and response to neoadjuvant chemoradiotherapy in rectal cancer. Onco Targets Ther. 2016;9:2735-42.", "doi": "10.2147/OTT.S105760", "nct": "", "pmid": 27226732, "source_id": 219, "source_type": "Journal", "url": "https://doi.org/10.2147/OTT.S105760" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Chemotherapy + Surgery", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Chemotherapy + Surgical removal", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 752, "context": "Muscle-Invasive", "created_on": "05/07/26", "deprecated": false, "description": "In a cohort of 86 patients with muscle-invasive bladder cancer, high MRE11 expression as assessed by IHC was associated with improved cancer-specific survival when treated with radical radiotherapy compared to low MRE11 expression as well as high-expression MRE11 treated with cystectomy.", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "MRE11" } ], "feature_id": 752, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Choudhury A, Nelson LD, Teo MTW, et al. MRE11 Expression Is Predictive of Cause-Specific Survival following Radical Radiotherapy for Muscle-Invasive Bladder Cancer Cancer Research. 2010; 70(18):7017-7026.", "doi": "10.1158/0008-5472.CAN-10-1202", "nct": "", "pmid": 20843819, "source_id": 220, "source_type": "Journal", "url": "https://doi.org/10.1158/0008-5472.CAN-10-1202" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Radiation Therapy", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Radiation", "therapy_type": "Radiation therapy", "validated": true }, { "assertion_id": 753, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Poor prognosis (< 15%) was observed for patients with amplified MYC with Medulloblastoma.", "disease": "Medulloblastoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "MYC" } ], "feature_id": 753, "feature_type": "copy_number" } ], "last_updated": "2019-01-29", "oncotree_code": "MBL", "oncotree_term": "Medulloblastoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Ryan SL, Schwalbe EC, Cole M, et al. MYC family amplification and clinical risk-factors interact to predict an extremely poor prognosis in childhood medulloblastoma. Acta Neuropathol. 2012;123(4):501-13.", "doi": "10.1007/s00401-011-0923-y", "nct": "", "pmid": 22139329, "source_id": 221, "source_type": "Journal", "url": "https://doi.org/10.1007/s00401-011-0923-y" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 754, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Amplification of 8q24 (which includes the MYC oncogene) was associated with poor outcomes in a study of 109 microdissected pancreatic adenocarcinoma tumors.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": "8q24", "direction": "Amplification", "feature_type": "copy_number", "gene": "MYC" } ], "feature_id": 754, "feature_type": "copy_number" } ], "last_updated": "2019-04-30", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Witkiewicz AK, Mcmillan EA, Balaji U, et al. Whole-exome sequencing of pancreatic cancer defines genetic diversity and therapeutic targets. Nat Commun. 2015;6:6744.", "doi": "10.1038/ncomms7744", "nct": "", "pmid": 25855536, "source_id": 54, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms7744" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 755, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PAK1 amplification showed reduced recurrence-free survival and decreased benefit from Tamoxifen in a randomized control trial of postmenopausal breast cancer patients.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": "11p13", "direction": "Amplification", "feature_type": "copy_number", "gene": "PAK1" } ], "feature_id": 755, "feature_type": "copy_number" } ], "last_updated": "2019-01-29", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Bostner, Josefine, et al. Amplification of CCND1 and PAK1 as predictors of recurrence and tamoxifen resistance in postmenopausal breast cancer. Oncogene 26.49 (2007): 6997-7005.", "doi": "10.1038/sj.onc.1210506", "nct": "", "pmid": 17486065, "source_id": 187, "source_type": "Journal", "url": "https://doi.org/10.1038/sj.onc.1210506" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 756, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PAK1 amplification showed reduced recurrence-free survival and decreased benefit from Tamoxifen in a randomized control trial of postmenopausal breast cancer patients.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": "11p13", "direction": "Amplification", "feature_type": "copy_number", "gene": "PAK1" } ], "feature_id": 756, "feature_type": "copy_number" } ], "last_updated": "2019-01-29", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Bostner, Josefine, et al. Amplification of CCND1 and PAK1 as predictors of recurrence and tamoxifen resistance in postmenopausal breast cancer. Oncogene 26.49 (2007): 6997-7005.", "doi": "10.1038/sj.onc.1210506", "nct": "", "pmid": 17486065, "source_id": 187, "source_type": "Journal", "url": "https://doi.org/10.1038/sj.onc.1210506" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tamoxifen", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "ER signaling inhibition", "therapy_type": "Hormone therapy", "validated": true }, { "assertion_id": 757, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Clinical benefit from nivolumab in clear cell renal cell carcinoma patients was associated with loss-of-function mutations in PBRM1.", "disease": "Renal Clear Cell Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "PBRM1" } ], "feature_id": 757, "feature_type": "copy_number" } ], "last_updated": "2018-11-29", "oncotree_code": "CCRCC", "oncotree_term": "Renal Clear Cell Carcinoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Miao D, Margolis CA, Gao W, et al. Genomic correlates of response to immune checkpoint therapies in clear cell renal cell carcinoma. Science. 2018;359(6377):801-806.", "doi": "10.1126/science.aan5951", "nct": "", "pmid": 29301960, "source_id": 153, "source_type": "Journal", "url": "https://doi.org/10.1126/science.aan5951" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nivolumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 758, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A heavily-pretreated, platinum-refractory ovarian cancer patient with PIK3CA amplification achieved radiologically stable disease for four months in a phase 1 clinical trial of pictisilib in solid tumors (RP2D of 330mg daily).", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "PIK3CA" } ], "feature_id": 758, "feature_type": "copy_number" } ], "last_updated": "2019-01-29", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Sarker D, Ang JE, Baird R, et al. First-in-human phase I study of pictilisib (GDC-0941), a potent pan-class I phosphatidylinositol-3-kinase (PI3K) inhibitor, in patients with advanced solid tumors. Clin Cancer Res. 2015;21(1):77-86.", "doi": "10.1158/1078-0432.CCR-14-0947", "nct": "NCT00876122", "pmid": 25370471, "source_id": 222, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-14-0947" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pictilisib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 759, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "AZ8186 showed pharmacodynamic modulation of p-Akt in PC3 PTEN-deficient prostate tumor bearing mice and showed complete inhibition of tumor growth in mouse PTEN-deficient PC3 prostate tumor xenograft models. The publication states that AZ8186 entered into phase 1 study.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "PTEN" } ], "feature_id": 759, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Barlaam B, Cosulich S, Degorce S, et al. Discovery of (R)-8-(1-(3,5-difluorophenylamino)ethyl)-N,N-dimethyl-2-morpholino-4-oxo-4H-chromene-6-carboxamide (AZD8186): a potent and selective inhibitor of PI3K-beta and PI3K-gamma for the treatment of PTEN-deficient cancers. J Med Chem. 2015;58(2):943-62.", "doi": "10.1021/jm501629p", "nct": "", "pmid": 25514658, "source_id": 158, "source_type": "Journal", "url": "https://doi.org/10.1021/jm501629p" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "PI3Kbeta Inhibitor AZD8186", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 760, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PTEN loss may predict resistance to immune checkpoint blockade", "disease": "Uterine Leiomyoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "PTEN" } ], "feature_id": 760, "feature_type": "copy_number" } ], "last_updated": "2019-03-07", "oncotree_code": "ULM", "oncotree_term": "Uterine Leiomyoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "George S, Miao D, Demetri GD, et al. Loss of PTEN Is Associated with Resistance to Anti-PD-1 Checkpoint Blockade Therapy in Metastatic Uterine Leiomyosarcoma. Immunity. 2017;46(2):197-204.", "doi": "10.1016/j.immuni.2017.02.001", "nct": "", "pmid": 28228279, "source_id": 159, "source_type": "Journal", "url": "https://doi.org/10.1016/j.immuni.2017.02.001" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 761, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PTEN loss in the setting of KRAS G12D mutation was associated with an increased sensitivity to mTOR inhibition in a mouse model.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "PTEN" } ], "feature_id": 761, "feature_type": "copy_number" } ], "last_updated": "2019-03-07", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Morran DC, Wu J, Jamieson NB, et al. Targeting mTOR dependency in pancreatic cancer. Gut. 2014;63(9):1481-9.", "doi": "10.1136/gutjnl-2013-306202", "nct": "", "pmid": 24717934, "source_id": 223, "source_type": "Journal", "url": "https://doi.org/10.1136/gutjnl-2013-306202" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 762, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PTEN loss may predict resistance to immune checkpoint blockade", "disease": "Uterine Leiomyoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "PTEN" } ], "feature_id": 762, "feature_type": "copy_number" } ], "last_updated": "2019-03-07", "oncotree_code": "ULM", "oncotree_term": "Uterine Leiomyoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Peng W, Chen JQ, Liu C, et al. Loss of PTEN Promotes Resistance to T Cell-Mediated Immunotherapy. Cancer Discov. 2016;6(2):202-16.", "doi": "10.1158/2159-8290.CD-15-0283", "nct": "", "pmid": 26645196, "source_id": 160, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-15-0283" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 763, "context": "Advanced", "created_on": "05/07/26", "deprecated": false, "description": "In a study of everolimus-treated patients with RCC from a phase 2 randomized trial, everolimus treated patients with retained (n=50) versus lost (n=50) PTEN IHC expression had median PFS 5.3 months versus 10.5 months (HR, 2.5; P < 001). Such differences were not seen with sunitinib.", "disease": "Renal Clear Cell Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "PTEN" } ], "feature_id": 763, "feature_type": "copy_number" } ], "last_updated": "2019-08-12", "oncotree_code": "RCC", "oncotree_term": "Renal Clear Cell Carcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Voss MH, Chen D, Reising A, et al. PTEN Expression, Not Mutation Status in, or, Correlates with the Outcome on Everolimus in Patients with Renal Cell Carcinoma Treated on the Randomized RECORD-3 Trial. Clin Cancer Res. 2019;25(2):506-514.", "doi": "10.1158/1078-0432.CCR-18-1833", "nct": "NCT00903175", "pmid": 30327302, "source_id": 149, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-18-1833" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Everolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 764, "context": "Advanced", "created_on": "05/07/26", "deprecated": false, "description": "In a study of everolimus-treated patients with RCC from a phase 2 randomized trial, everolimus treated patients with retained (n=50) versus lost (n=50) PTEN IHC expression had median PFS 5.3 months versus 10.5 months (HR, 2.5; P < 001). Such differences were not seen with sunitinib.", "disease": "Renal Clear Cell Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "PTEN" } ], "feature_id": 764, "feature_type": "copy_number" } ], "last_updated": "2019-08-12", "oncotree_code": "RCC", "oncotree_term": "Renal Clear Cell Carcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Voss MH, Chen D, Reising A, et al. PTEN Expression, Not Mutation Status in, or, Correlates with the Outcome on Everolimus in Patients with Renal Cell Carcinoma Treated on the Randomized RECORD-3 Trial. Clin Cancer Res. 2019;25(2):506-514.", "doi": "10.1158/1078-0432.CCR-18-1833", "nct": "NCT00903175", "pmid": 30327302, "source_id": 149, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-18-1833" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Sunitinib", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "VEGF/VEGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 765, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Deletion of chromosome 13 seems to have an amplifying effect on cell cycle gene expression and is reported to be associated with short event-free survival (EFS) and overall survival (OS). This copy loss event results in haploinsufficiency of RB1 and other genes mapped to chromosome 13.", "disease": "Multiple Myeloma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": "13", "direction": "Deletion", "feature_type": "copy_number", "gene": "RB1" } ], "feature_id": 765, "feature_type": "copy_number" } ], "last_updated": "2023-11-02", "oncotree_code": "MM", "oncotree_term": "Multiple Myeloma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Multiple Myeloma V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 28, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/myeloma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 766, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Deletion of 17p13 leads to LoH of TP53 and is considered a high-risk feature of multiple myeloma.", "disease": "Multiple Myeloma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": "17p13", "direction": "Deletion", "feature_type": "copy_number", "gene": "TP53" } ], "feature_id": 766, "feature_type": "copy_number" } ], "last_updated": "2023-11-02", "oncotree_code": "MM", "oncotree_term": "Multiple Myeloma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Multiple Myeloma V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 28, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/myeloma_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 767, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Downmodulation of TPX2 and AURKA in the presence of 20q copy gain was shown to tumor growth", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": "20q11", "direction": "Amplification", "feature_type": "copy_number", "gene": "TPX2" } ], "feature_id": 767, "feature_type": "copy_number" } ], "last_updated": "2017-11-03", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Sillars-Hardebol, Anke H., et al. TPX2 and AURKA promote 20q amplicon-driven colorectal adenoma to carcinoma progression. Gut 61.11 (2012): 1568-1575.", "doi": "10.1136/gutjnl-2011-301153", "nct": "", "pmid": 22207630, "source_id": 184, "source_type": "Journal", "url": "https://doi.org/10.1136/gutjnl-2011-301153" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 768, "context": "Unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to pembrolizumab for the treatment of adult and pediatric patients with unresectable or metastatic, microsatellite instability-high (MSI-H) or mismatch repair deficient solid tumors that have progressed following prior treatment and who have no satisfactory alternative treatment options.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "microsatellite_stability", "status": "MSI-High" } ], "feature_id": 768, "feature_type": "microsatellite_stability" } ], "last_updated": "2020-11-12", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Merck Sharp & Dohme Corp. Keytruda (pembrolizumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/125514s085lbl.pdf. Revised October 2020. Accessed November 4, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 224, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/125514s085lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 769, "context": "Unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to pembrolizumab for the treatment of adult and pediatric patients with unresectable or metastatic, microsatellite instability-high (MSI-H) or mismatch repair deficient colorectal cancer that has progressed following treatment with a fluoropyrimidine, oxaliplatin, and irinotecan.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "microsatellite_stability", "status": "MSI-High" } ], "feature_id": 769, "feature_type": "microsatellite_stability" } ], "last_updated": "2020-11-12", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Merck Sharp & Dohme Corp. Keytruda (pembrolizumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/125514s085lbl.pdf. Revised October 2020. Accessed November 4, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 224, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/125514s085lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 770, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "5-Fluorouracil is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with MSI-High colorectal cancer. These patients appear to not benefit from, and may be resistant to, 5-fluorouracil therapy.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "microsatellite_stability", "status": "MSI-High" } ], "feature_id": 770, "feature_type": "microsatellite_stability" } ], "last_updated": "2025-02-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 80, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Fluorouracil", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "Thymidylate synthase inhibition", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 771, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "5-Fluorouracil is not recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option for patients with MSI-High colorectal cancer. These patients appear to not benefit from, and may be resistant to, 5-fluorouracil therapy.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "microsatellite_stability", "status": "MSI-High" } ], "feature_id": 771, "feature_type": "microsatellite_stability" } ], "last_updated": "2025-02-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 80, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Fluorouracil", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Thymidylate synthase inhibition", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 772, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Patients with MSI-High colorectal cancer often have a favorable prognosis.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "feature_type": "microsatellite_stability", "status": "MSI-High" } ], "feature_id": 772, "feature_type": "microsatellite_stability" } ], "last_updated": "2023-11-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Colon Cancer V.2.2016. \u00a9 National Comprehensive Cancer Network, Inc. 2016. All rights reserved. Accessed November 5 2016. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 80, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/colon_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 773, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "A phase II study of 32 colorectal cancer patients (and 9 noncolorectal cancer patients) found an association between mismatch repair deficiency (measured by MSI status) and both immune-related objective response rate (40% of patients with MSI-High vs. 0% in MSI-Low) and immune-related progression-free survival rate (78% of MSI-High patients at 20 weeks vs. 11% in MSI-Low). Post-hoc cohort comparison showed hazard ratio for disease progression or death of 0.10 and for death of 0.22.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "microsatellite_stability", "status": "MSI-High" } ], "feature_id": 773, "feature_type": "microsatellite_stability" } ], "last_updated": "2023-10-31", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Le DT, Uram JN, Wang H, et al. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency. N Engl J Med. 2015;372(26):2509-20.", "doi": "10.1056/NEJMoa1500596", "nct": "NCT01876511", "pmid": 26028255, "source_id": 147, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1500596" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 774, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Signature 10 is related to mutant pole, which may suggest sensitivity to immunotherapy.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS10a", "feature_type": "mutational_signature" } ], "feature_id": 774, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Inferential", "sources": [ { "citation": "Le DT, Uram JN, Wang H, et al. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency. N Engl J Med. 2015;372(26):2509-20.", "doi": "10.1056/NEJMoa1500596", "nct": "NCT01876511", "pmid": 26028255, "source_id": 147, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1500596" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 775, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Signature 10 is related to mutant pole, which may suggest sensitivity to immunotherapy.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS10b", "feature_type": "mutational_signature" } ], "feature_id": 775, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Inferential", "sources": [ { "citation": "Le DT, Uram JN, Wang H, et al. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency. N Engl J Med. 2015;372(26):2509-20.", "doi": "10.1056/NEJMoa1500596", "nct": "NCT01876511", "pmid": 26028255, "source_id": 147, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1500596" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 776, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "COSMIC Signature 10 is observed in some of the most hypermutant samples and recurrent POLE mutations. POLE mutant tumors are being included along with MMR-deficient tumors in several ongoing trials for sensitivity to immunotherapy.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS10a", "feature_type": "mutational_signature" } ], "feature_id": 776, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Inferential", "sources": [ { "citation": "Mouw KW, Goldberg MS, Konstantinopoulos PA, D'Andrea AD. DNA Damage and Repair Biomarkers of Immunotherapy Response Cancer Discov. 2017; 7(7):675-693.", "doi": "10.1158/2159-8290.CD-17-0226", "nct": "", "pmid": 28630051, "source_id": 157, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-17-0226" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Durvalumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 777, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "COSMIC Signature 10 is observed in some of the most hypermutant samples and recurrent POLE mutations. POLE mutant tumors are being included along with MMR-deficient tumors in several ongoing trials for sensitivity to immunotherapy.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS10b", "feature_type": "mutational_signature" } ], "feature_id": 777, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Inferential", "sources": [ { "citation": "Mouw KW, Goldberg MS, Konstantinopoulos PA, D'Andrea AD. DNA Damage and Repair Biomarkers of Immunotherapy Response Cancer Discov. 2017; 7(7):675-693.", "doi": "10.1158/2159-8290.CD-17-0226", "nct": "", "pmid": 28630051, "source_id": 157, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-17-0226" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Durvalumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 778, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "COSMIC Signature 10 is observed in some of the most hypermutant samples and recurrent POLE mutations. POLE mutant tumors are being included along with MMR-deficient tumors in several ongoing trials for sensitivity to immunotherapy.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS10a", "feature_type": "mutational_signature" } ], "feature_id": 778, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Inferential", "sources": [ { "citation": "Mouw KW, Goldberg MS, Konstantinopoulos PA, D'Andrea AD. DNA Damage and Repair Biomarkers of Immunotherapy Response Cancer Discov. 2017; 7(7):675-693.", "doi": "10.1158/2159-8290.CD-17-0226", "nct": "", "pmid": 28630051, "source_id": 157, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-17-0226" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 779, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "COSMIC Signature 10 is observed in some of the most hypermutant samples and recurrent POLE mutations. POLE mutant tumors are being included along with MMR-deficient tumors in several ongoing trials for sensitivity to immunotherapy.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS10b", "feature_type": "mutational_signature" } ], "feature_id": 779, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "Inferential", "sources": [ { "citation": "Mouw KW, Goldberg MS, Konstantinopoulos PA, D'Andrea AD. DNA Damage and Repair Biomarkers of Immunotherapy Response Cancer Discov. 2017; 7(7):675-693.", "doi": "10.1158/2159-8290.CD-17-0226", "nct": "", "pmid": 28630051, "source_id": 157, "source_type": "Journal", "url": "https://doi.org/10.1158/2159-8290.CD-17-0226" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 780, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "APOBEC signature (COSMIC 2) suggests sensitivity to immunotherapy in bladder cancer.", "disease": "Urethral Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS2", "feature_type": "mutational_signature" } ], "feature_id": 780, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "UCU", "oncotree_term": "Urethral Urothelial Carcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Mullane SA, Werner L, Rosenberg J, et al. Correlation of Apobec Mrna Expression with overall Survival and PD-L1 expression in urothelial carcinoma. Sci Rep. 2016; 6:27702.", "doi": "10.1038/srep27702", "nct": "", "pmid": 27283319, "source_id": 225, "source_type": "Journal", "url": "https://doi.org/10.1038/srep27702" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Durvalumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 781, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "APOBEC signature (COSMIC 2) suggests sensitivity to immunotherapy in bladder cancer.", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS2", "feature_type": "mutational_signature" } ], "feature_id": 781, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Mullane SA, Werner L, Rosenberg J, et al. Correlation of Apobec Mrna Expression with overall Survival and PD-L1 expression in urothelial carcinoma. Sci Rep. 2016; 6:27702.", "doi": "10.1038/srep27702", "nct": "", "pmid": 27283319, "source_id": 225, "source_type": "Journal", "url": "https://doi.org/10.1038/srep27702" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Durvalumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 782, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Responders to platinum based chemotherapy exhibit COSMIC signature 3 (HR signature) mutations in pancreatic cancer.", "disease": "Gastric Remnant Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS3", "feature_type": "mutational_signature" } ], "feature_id": 782, "feature_type": "mutational_signature" } ], "last_updated": "2025-02-13", "oncotree_code": "GRC", "oncotree_term": "Gastric Remnant Adenocarcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Alexandrov LB, Nik-zainal S, Siu HC, Leung SY, Stratton MR. A mutational signature in gastric cancer suggests therapeutic strategies. Nat Commun. 2015;6:8683.", "doi": "10.1038/ncomms9683", "nct": "", "pmid": 26511885, "source_id": 226, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms9683" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 783, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Responders to platinum based chemotherapy usually exhibited COSMIC signature 3 (HR signature), which may suggest sensitivity to PARP inhibition.", "disease": "Gastric Remnant Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS3", "feature_type": "mutational_signature" } ], "feature_id": 783, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "GRC", "oncotree_term": "Gastric Remnant Adenocarcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Alexandrov LB, Nik-zainal S, Siu HC, Leung SY, Stratton MR. A mutational signature in gastric cancer suggests therapeutic strategies. Nat Commun. 2015;6:8683.", "doi": "10.1038/ncomms9683", "nct": "", "pmid": 26511885, "source_id": 226, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms9683" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 784, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Responders to platinum based chemotherapy usually exhibited COSMIC signature 3 (HR signature), which may suggest sensitivity to PARP inhibition.", "disease": "Gastric Remnant Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS3", "feature_type": "mutational_signature" } ], "feature_id": 784, "feature_type": "mutational_signature" } ], "last_updated": "2025-02-13", "oncotree_code": "GRC", "oncotree_term": "Gastric Remnant Adenocarcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Alexandrov LB, Nik-zainal S, Siu HC, Leung SY, Stratton MR. A mutational signature in gastric cancer suggests therapeutic strategies. Nat Commun. 2015;6:8683.", "doi": "10.1038/ncomms9683", "nct": "", "pmid": 26511885, "source_id": 226, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms9683" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 785, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Responders to platinum based chemotherapy usually exhibited COSMIC signature 3 (HR signature), which may suggest sensitivity to PARP inhibition.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS3", "feature_type": "mutational_signature" } ], "feature_id": 785, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Alexandrov LB, Nik-zainal S, Siu HC, Leung SY, Stratton MR. A mutational signature in gastric cancer suggests therapeutic strategies. Nat Commun. 2015;6:8683.", "doi": "10.1038/ncomms9683", "nct": "", "pmid": 26511885, "source_id": 226, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms9683" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 786, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Responders to platinum based chemotherapy usually exhibited COSMIC signature 3 (HR signature), which may suggest sensitivity to PARP inhibition.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS3", "feature_type": "mutational_signature" } ], "feature_id": 786, "feature_type": "mutational_signature" } ], "last_updated": "2025-02-13", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Alexandrov LB, Nik-zainal S, Siu HC, Leung SY, Stratton MR. A mutational signature in gastric cancer suggests therapeutic strategies. Nat Commun. 2015;6:8683.", "doi": "10.1038/ncomms9683", "nct": "", "pmid": 26511885, "source_id": 226, "source_type": "Journal", "url": "https://doi.org/10.1038/ncomms9683" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 787, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Responders to platinum based chemotherapy exhibit COSMIC signature 3 (HR signature) mutations in pancreatic cancer.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS3", "feature_type": "mutational_signature" } ], "feature_id": 787, "feature_type": "mutational_signature" } ], "last_updated": "2025-02-13", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Waddell N, Pajic M, Patch AM, et al. Whole genomes redefine the mutational landscape of pancreatic cancer. Nature. 2015;518(7540):495-501.", "doi": "10.1038/nature14169", "nct": "", "pmid": 25719666, "source_id": 85, "source_type": "Journal", "url": "https://doi.org/10.1038/nature14169" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Platinum Compound", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 788, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In a cohort of 34 non-small cell lung cancer patients with pembrolizumab, the presence of a smoking signature (transversion-high tumors) was associated with a higher overall response rate (56% in transversion-high tumors, vs. 17% in transversion-low [never-smoker] tumors), a higher rate of DCB (77% vs. 22%), and a longer PFS.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS4", "feature_type": "mutational_signature" } ], "feature_id": 788, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Rizvi NA, Hellmann MD, Snyder A, et al. Cancer immunology. Mutational landscape determines sensitivity to PD-1 blockade in non-small cell lung cancer. Science. 2015;348(6230):124-8.", "doi": "10.1126/science.aaa1348", "nct": "", "pmid": 25765070, "source_id": 136, "source_type": "Journal", "url": "https://doi.org/10.1126/science.aaa1348" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 789, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Smoking signature (COSMIC 4) suggests sensitivity to immunotherapy in lung cancer.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS4", "feature_type": "mutational_signature" } ], "feature_id": 789, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "Rizvi NA, Hellmann MD, Snyder A, et al. Cancer immunology. Mutational landscape determines sensitivity to PD-1 blockade in non-small cell lung cancer. Science. 2015;348(6230):124-8.", "doi": "10.1126/science.aaa1348", "nct": "", "pmid": 25765070, "source_id": 136, "source_type": "Journal", "url": "https://doi.org/10.1126/science.aaa1348" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 790, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "COSMIC Signature 5 is associated with somatic ERCC2 mutations, which may suggest sensitivity to cisplatin based chemotherapy.", "disease": "Bladder Urothelial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS5", "feature_type": "mutational_signature" } ], "feature_id": 790, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "BLCA", "oncotree_term": "Bladder Urothelial Carcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Kim J, Mouw KW, Polak P, et al. Somatic ERCC2 mutations are associated with a distinct genomic signature in urothelial tumors. Nat Genet. 2016;48(6):600-606.", "doi": "10.1038/ng.3557", "nct": "", "pmid": 27111033, "source_id": 227, "source_type": "Journal", "url": "https://doi.org/10.1038/ng.3557" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cisplatin", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 791, "context": "HRD-positive advanced", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration expanded the indication of olaparib to include its combination with bevacizumab for first-line maintenance treatment of adults with advanced epithelial ovarian, fallopian tube, or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy and whose cancer is associated with homologous recombination deficiency positive status defined by either a deleterious or suspected deleterious BRCA mutation, and/or genomic instability.", "disease": "Ovarian Epithelial Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS3", "feature_type": "mutational_signature" } ], "feature_id": 791, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "OVT", "oncotree_term": "Ovarian Epithelial Tumor", "predictive_implication": "Inferential", "sources": [ { "citation": "AstraZeneca Pharmaceuticals LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 87, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bevacizumab + Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "VEGF/VEGFR inhibition + PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 792, "context": "HRD-positive advanced", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration expanded the indication of olaparib to include its combination with bevacizumab for first-line maintenance treatment of adults with advanced epithelial ovarian, fallopian tube, or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy and whose cancer is associated with homologous recombination deficiency positive status defined by either a deleterious or suspected deleterious BRCA mutation, and/or genomic instability.", "disease": "High-Grade Serous Fallopian Tube Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS3", "feature_type": "mutational_signature" } ], "feature_id": 792, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "HGSFT", "oncotree_term": "High-Grade Serous Fallopian Tube Cancer", "predictive_implication": "Inferential", "sources": [ { "citation": "AstraZeneca Pharmaceuticals LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 87, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bevacizumab + Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "VEGF/VEGFR inhibition + PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 793, "context": "HRD-positive advanced", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration expanded the indication of olaparib to include its combination with bevacizumab for first-line maintenance treatment of adults with advanced epithelial ovarian, fallopian tube, or primary peritoneal cancer who are in complete or partial response to first-line platinum-based chemotherapy and whose cancer is associated with homologous recombination deficiency positive status defined by either a deleterious or suspected deleterious BRCA mutation, and/or genomic instability.", "disease": "Peritoneal Serous Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cosmic_signature": "SBS3", "feature_type": "mutational_signature" } ], "feature_id": 793, "feature_type": "mutational_signature" } ], "last_updated": "2023-10-31", "oncotree_code": "PSEC", "oncotree_term": "Peritoneal Serous Carcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "AstraZeneca Pharmaceuticals LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf. Revised November 2020. Accessed November 12th, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 87, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/208558s018lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bevacizumab + Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "VEGF/VEGFR inhibition + PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 794, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Nivolumab (Opdivo) in combination with ipilimumab (Yervoy) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option as an immunotherapy agent for patients with metastatic non-small cell lung cancer whose tumors have a high tumor mutational burden (TMB)", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "classification": "High", "feature_type": "mutational_burden", "minimum_mutations": null, "mutations_per_mb": null } ], "feature_id": 794, "feature_type": "mutational_burden" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.5.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12, 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 11, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ipilimumab + Nivolumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CTLA-4 inhibition + PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 795, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "Nivolumab (Opdivo) is recommended by the National Comprehensive Cancer Network\u00ae (NCCN\u00ae) as a treatment option as an immunotherapy agent for patients with metastatic non-small cell lung cancer whose tumors have a high tumor mutational burden (TMB)", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "classification": "High", "feature_type": "mutational_burden", "minimum_mutations": null, "mutations_per_mb": null } ], "feature_id": 795, "feature_type": "mutational_burden" } ], "last_updated": "2023-11-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Non-Small Lung Cancer V.5.2019. \u00a9 National Comprehensive Cancer Network, Inc. 2019. All rights reserved. Accessed August 12, 2019. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 11, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/nscl_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Nivolumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 796, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In a validation set of 18 non-small cell lung cancer patients treated with pembrolizumab, a nonsynonymous mutational burden >= 178 was associated with durable clinical response in some patients (75% of patients with burden >= 178 showed a response, compared to 14% patients with burden < 178 that showed a response; sensitivity of 86%, specificity of 75%).", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "classification": "High", "feature_type": "mutational_burden", "minimum_mutations": "178", "mutations_per_mb": null } ], "feature_id": 796, "feature_type": "mutational_burden" } ], "last_updated": "2017-03-12", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Rizvi NA, Hellmann MD, Snyder A, et al. Cancer immunology. Mutational landscape determines sensitivity to PD-1 blockade in non-small cell lung cancer. Science. 2015;348(6230):124-8.", "doi": "10.1126/science.aaa1348", "nct": "", "pmid": 25765070, "source_id": 136, "source_type": "Journal", "url": "https://doi.org/10.1126/science.aaa1348" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 797, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "In a study of malignant melanoma using a discovery cohort of 25 patients and a validation cohort of 39 patients, a significantly higher muational burden was seen in patients with a long-term clinical benefit vs. patients with minimal or no benefit to ipilimumab treatment.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "classification": "High", "feature_type": "mutational_burden", "minimum_mutations": "100", "mutations_per_mb": null } ], "feature_id": 797, "feature_type": "mutational_burden" } ], "last_updated": "2017-03-12", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Snyder A, Makarov V, Merghoub T, et al. Genetic basis for clinical response to CTLA-4 blockade in melanoma. N Engl J Med. 2014;371(23):2189-99.", "doi": "10.1056/NEJMoa1406498", "nct": "", "pmid": 25409260, "source_id": 228, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1406498" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ipilimumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CTLA-4 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 798, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "A study of pretreatment biopsies of tumors from 110 patients showed that patients with a mutational load of >= 100 were significantly more likely to have a clinical benefit to ipilimumab.", "disease": "Melanoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "classification": "High", "feature_type": "mutational_burden", "minimum_mutations": "100", "mutations_per_mb": null } ], "feature_id": 798, "feature_type": "mutational_burden" } ], "last_updated": "2017-03-12", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Van Allen EM, Miao D, Schilling B, et al. Genomic correlates of response to CTLA-4 blockade in metastatic melanoma. Science. 2015;350(6257):207-11.", "doi": "10.1126/science.aad0095", "nct": "", "pmid": 26359337, "source_id": 229, "source_type": "Journal", "url": "https://doi.org/10.1126/science.aad0095" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ipilimumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CTLA-4 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 799, "context": "Unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has approved pembrolizumab for the treatment of adult and pediatric patients with unresectable or metastatic tumor mutational burden-high (TMB-H) [>= 10 mutations/megabase (mut/Mb)] solid tumors, as determined by an FDA-approved test, that have progressed following prior treatment and who have no satisfactory alternative treatment options.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "classification": "High", "feature_type": "mutational_burden", "minimum_mutations": null, "mutations_per_mb": "10" } ], "feature_id": 799, "feature_type": "mutational_burden" } ], "last_updated": "2021-09-16", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Merck Sharp & Dohme Corp. Keytruda (pembrolizumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/125514s085lbl.pdf. Revised October 2020. Accessed November 4, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 224, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/125514s085lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 800, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "HCT116 colorectal cancer cell lines are heterozygous for c.3380C>A and sensitive to PARP inhibition following shRNA depletion of ATM. Deletion of p53 enhances sensitivity.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "knockdown", "gene": "ATM", "technique": "shRNA" } ], "feature_id": 800, "feature_type": "knockdown" } ], "last_updated": "2023-10-05", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Wang C, Jette N, Moussienko D, Bebb DG, Lees-Miller SP. ATM-Deficient Colorectal Cancer Cells Are Sensitive to the PARP Inhibitor Olaparib Translational Oncology. 2017; 10(2):190-196.", "doi": "10.1016/j.tranon.2017.01.007", "nct": "", "pmid": 28182994, "source_id": 57, "source_type": "Journal", "url": "https://doi.org/10.1016/j.tranon.2017.01.007" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 801, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss of antigen presentation via B2M loss of function mutations results in increased survival of cancer cells in the presence of tumor infiltrating lymphocytes.", "disease": "Melanoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "feature_type": "knockdown", "gene": "B2M", "technique": "CRISPR-Cas9" } ], "feature_id": 801, "feature_type": "knockdown" } ], "last_updated": "2019-04-16", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Patel SJ, Sanjana NE, Kishton RJ, et al. Identification of essential genes for cancer immunotherapy Nature. 2017; 548(7669):537-542.", "doi": "10.1038/nature23477", "nct": "", "pmid": 28783722, "source_id": 230, "source_type": "Journal", "url": "https://doi.org/10.1038/nature23477" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 802, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "shRNA knockout in ovarian cancer suggests suggests sensitivity to PARP1/2 inhibition, specifically olaparib.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "knockdown", "gene": "CDK12", "technique": "shRNA" } ], "feature_id": 802, "feature_type": "knockdown" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Preclinical", "sources": [ { "citation": "Bajrami I, Frankum JR, Konde A, et al. Genome-wide profiling of genetic synthetic lethality identifies CDK12 as a novel determinant of PARP1/2 inhibitor sensitivity. Cancer Res. 2014;74(1):287-97.", "doi": "10.1158/0008-5472.CAN-13-2541", "nct": "", "pmid": 24240700, "source_id": 231, "source_type": "Journal", "url": "https://doi.org/10.1158/0008-5472.CAN-13-2541" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 803, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "siRNA knockout, gene depletion, of CDK12 shows sensitivity to PARP inhibitor veliparib in ovarian cancer cell lines.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "knockdown", "gene": "CDK12", "technique": "siRNA" } ], "feature_id": 803, "feature_type": "knockdown" } ], "last_updated": "2017-11-03", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Preclinical", "sources": [ { "citation": "Joshi PM, Sutor SL, Huntoon CJ, Karnitz LM. Ovarian cancer-associated mutations disable catalytic activity of CDK12, a kinase that promotes homologous recombination repair and resistance to cisplatin and poly(ADP-ribose) polymerase inhibitors. J Biol Chem. 2014;289(13):9247-53.", "doi": "10.1074/jbc.M114.551143", "nct": "", "pmid": 24554720, "source_id": 232, "source_type": "Journal", "url": "https://doi.org/10.1074/jbc.M114.551143" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Veliparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 804, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "CPT1A is involved in fatty acid oxidation, a key component of some tumor's metabolic processes. CPT1A knockdown in some melanoma BRAF V600E cell lines resulted in decreased proliferation and tumorigenesis.", "disease": "Melanoma", "favorable_prognosis": 1, "features": [ { "attributes": [ { "feature_type": "knockdown", "gene": "CPT1A", "technique": "shRNA" } ], "feature_id": 804, "feature_type": "knockdown" } ], "last_updated": "2017-11-03", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Sung GJ, Choi HK, Kwak S, et al. Targeting CPT1A enhances metabolic therapy in human melanoma cells with the BRAF V600E mutation. Int J Biochem Cell Biol. 2016;81(Pt A):76-81.", "doi": "10.1016/j.biocel.2016.10.019", "nct": "", "pmid": 27793752, "source_id": 233, "source_type": "Journal", "url": "https://doi.org/10.1016/j.biocel.2016.10.019" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 805, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "RNAi knockdown of RAD17 in the HME-CC breast cancer cell line resulted in increased sensitivity to ABT-888, Veliparib (PARP inhibitor). If RAD50 is also knocked out, a further increase in sensitivity is observed.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "knockdown", "gene": "RAD17", "technique": "shRNA" } ], "feature_id": 805, "feature_type": "knockdown" } ], "last_updated": "2017-11-03", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Weigman VJ, Chao HH, Shabalin AA, et al. Basal-like Breast cancer DNA copy number losses identify genes involved in genomic instability, response to therapy, and patient survival. Breast Cancer Res Treat. 2012;133(3):865-80.", "doi": "10.1007/s10549-011-1846-y", "nct": "", "pmid": 22048815, "source_id": 234, "source_type": "Journal", "url": "https://doi.org/10.1007/s10549-011-1846-y" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Veliparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 806, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "RNAi knockdown of RAD17 in the HME-CC breast cancer cell line resulted in increased sensitivity to carboplatin. A further increase in sensitivity occurred when knocked down with RAD50.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "knockdown", "gene": "RAD17", "technique": "shRNA" } ], "feature_id": 806, "feature_type": "knockdown" } ], "last_updated": "2017-11-03", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Weigman VJ, Chao HH, Shabalin AA, et al. Basal-like Breast cancer DNA copy number losses identify genes involved in genomic instability, response to therapy, and patient survival. Breast Cancer Res Treat. 2012;133(3):865-80.", "doi": "10.1007/s10549-011-1846-y", "nct": "", "pmid": 22048815, "source_id": 234, "source_type": "Journal", "url": "https://doi.org/10.1007/s10549-011-1846-y" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Carboplatin", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 807, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "RNAi knockdown of RAD50 in the HME-CC breast cancer cell line resulted in increased resistance to carboplatin.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "knockdown", "gene": "RAD50", "technique": "shRNA" } ], "feature_id": 807, "feature_type": "knockdown" } ], "last_updated": "2017-11-03", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Weigman VJ, Chao HH, Shabalin AA, et al. Basal-like Breast cancer DNA copy number losses identify genes involved in genomic instability, response to therapy, and patient survival. Breast Cancer Res Treat. 2012;133(3):865-80.", "doi": "10.1007/s10549-011-1846-y", "nct": "", "pmid": 22048815, "source_id": 234, "source_type": "Journal", "url": "https://doi.org/10.1007/s10549-011-1846-y" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Carboplatin", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "Platinum-based chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 808, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss of antigen presentation via TAP2 loss of function mutations results in increased survival of cancer cells in the presence of tumor infiltrating lymphocytes.", "disease": "Melanoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "feature_type": "knockdown", "gene": "TAP2", "technique": "CRISPR-Cas9" } ], "feature_id": 808, "feature_type": "knockdown" } ], "last_updated": "2019-04-16", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Patel SJ, Sanjana NE, Kishton RJ, et al. Identification of essential genes for cancer immunotherapy Nature. 2017; 548(7669):537-542.", "doi": "10.1038/nature23477", "nct": "", "pmid": 28783722, "source_id": 230, "source_type": "Journal", "url": "https://doi.org/10.1038/nature23477" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 809, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "PPARGC1A silencing causes poorly metastatic melanoma cells to become invasive, while PPARGC1A rescue suppresses metastasis in human melanoma tumor samples.", "disease": "Melanoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "feature_type": "knockdown", "gene": "PPARGC1A", "technique": "CRSPR-Cas9" } ], "feature_id": 809, "feature_type": "knockdown" } ], "last_updated": "2019-04-30", "oncotree_code": "MEL", "oncotree_term": "Melanoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Luo C, Lim JH, Lee Y, et al. A PGC1alpha-mediated transcriptional axis suppresses melanoma metastasis. Nature. 2016;537(7620):422-426.", "doi": "10.1038/nature19347", "nct": "", "pmid": 27580028, "source_id": 235, "source_type": "Journal", "url": "https://doi.org/10.1038/nature19347" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 810, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "WGD was associated with adverse survival pan-cancer in patients with advanced disease and in cancers with heterogeneous clinical outcomes, even following the development of metastasis.", "disease": "", "favorable_prognosis": 0, "features": [ { "attributes": [ { "event": "Whole genome doubling", "feature_type": "aneuploidy" } ], "feature_id": 810, "feature_type": "aneuploidy" } ], "last_updated": "2018-09-01", "oncotree_code": "", "oncotree_term": "", "predictive_implication": "Inferential", "sources": [ { "citation": "Bielski CM, Zehir A, Penson AV, et al. Genome doubling shapes the evolution and prognosis of advanced cancers Nat Genet. 2018; 50(8):1189-1195.", "doi": "10.1038/s41588-018-0165-1", "nct": "", "pmid": 30013179, "source_id": 236, "source_type": "Journal", "url": "https://doi.org/10.1038/s41588-018-0165-1" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 811, "context": "Advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to dabrafenib in combination with trametinib for the treatment of adult and pediatric patients 6 years of age and older with unresectable or metastatic solid tumors with BRAF V600E mutation who have progressed following prior treatment and have no satisfactory alternative treatment options. This indication is approved under accelerated approval based on overall response rate and duration of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in a confirmatory trial(s).", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 811, "feature_type": "somatic_variant" } ], "last_updated": "2022-07-07", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Tafinlar (dabrafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/202806s022lbl.pdf. Revised March 2022. Accessed July 7, 2022.", "doi": "", "nct": "", "pmid": "", "source_id": 237, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/202806s022lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dabrafenib + Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition + MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 812, "context": "newly diagnosed AML who are 75 years or older, or who have comorbities that preclude use of intensive induction chemotherapy.", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to ivosidenib in combination with azacitidine or as a monotherapy indicated for patients with a susceptible iDH1 mutation as detected by an FDA-approved test for the treatment of newly diagnosed AML in adults 75 years or older, or who have comorbidities that preclude use of intensive induction chemotherapy.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.395G>A", "chromosome": "2", "end_position": "209113112", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132H", "reference_allele": "C", "rsid": "rs121913500", "start_position": "209113112", "variant_annotation": "Missense" } ], "feature_id": 812, "feature_type": "somatic_variant" } ], "last_updated": "2022-07-07", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Tibsovo (ivosidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/211192s009lbl.pdf. Revised May 2022. Accessed July 7th, 2022.", "doi": "", "nct": "", "pmid": "", "source_id": 238, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/211192s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ivosidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 813, "context": "newly diagnosed AML who are 75 years or older, or who have comorbities that preclude use of intensive induction chemotherapy.", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to ivosidenib in combination with azacitidine or as a monotherapy indicated for patients with a susceptible iDH1 mutation as detected by an FDA-approved test for the treatment of newly diagnosed AML in adults 75 years or older, or who have comorbidities that preclude use of intensive induction chemotherapy.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.394C>T", "chromosome": "2", "end_position": "209113113", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132C", "reference_allele": "G", "rsid": "rs121913499", "start_position": "209113113", "variant_annotation": "Missense" } ], "feature_id": 813, "feature_type": "somatic_variant" } ], "last_updated": "2022-07-07", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Tibsovo (ivosidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/211192s009lbl.pdf. Revised May 2022. Accessed July 7th, 2022.", "doi": "", "nct": "", "pmid": "", "source_id": 238, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/211192s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ivosidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 814, "context": "newly diagnosed AML who are 75 years or older, or who have comorbities that preclude use of intensive induction chemotherapy.", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to ivosidenib in combination with azacitidine or as a monotherapy indicated for patients with a susceptible iDH1 mutation as detected by an FDA-approved test for the treatment of newly diagnosed AML in adults 75 years or older, or who have comorbidities that preclude use of intensive induction chemotherapy.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.395G>A", "chromosome": "2", "end_position": "209113112", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132H", "reference_allele": "C", "rsid": "rs121913500", "start_position": "209113112", "variant_annotation": "Missense" } ], "feature_id": 814, "feature_type": "somatic_variant" } ], "last_updated": "2022-07-07", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Tibsovo (ivosidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/211192s009lbl.pdf. Revised May 2022. Accessed July 7th, 2022.", "doi": "", "nct": "", "pmid": "", "source_id": 238, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/211192s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Azacitidine + Ivosidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 815, "context": "newly diagnosed AML who are 75 years or older, or who have comorbities that preclude use of intensive induction chemotherapy.", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to ivosidenib in combination with azacitidine or as a monotherapy indicated for patients with a susceptible iDH1 mutation as detected by an FDA-approved test for the treatment of newly diagnosed AML in adults 75 years or older, or who have comorbidities that preclude use of intensive induction chemotherapy.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.394C>T", "chromosome": "2", "end_position": "209113113", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132C", "reference_allele": "G", "rsid": "rs121913499", "start_position": "209113113", "variant_annotation": "Missense" } ], "feature_id": 815, "feature_type": "somatic_variant" } ], "last_updated": "2022-07-07", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Tibsovo (ivosidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/211192s009lbl.pdf. Revised May 2022. Accessed July 7th, 2022.", "doi": "", "nct": "", "pmid": "", "source_id": 238, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/211192s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Azacitidine + Ivosidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 816, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "A phase II study of 32 colorectal cancer patients (and 9 noncolorectal cancer patients) found an association between mismatch repair deficiency (measured by MSI status) and both immune-related objective response rate (40% of patients with MSI-High vs. 0% in MSI-Low) and immune-related progression-free survival rate (78% of MSI-High patients at 20 weeks vs. 11% in MSI-Low). Post-hoc cohort comparison showed hazard ratio for disease progression or death of 0.10 and for death of 0.22.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "microsatellite_stability", "status": "MSI-High" } ], "feature_id": 816, "feature_type": "microsatellite_stability" } ], "last_updated": "2023-10-31", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Le DT, Uram JN, Wang H, et al. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency. N Engl J Med. 2015;372(26):2509-20.", "doi": "10.1056/NEJMoa1500596", "nct": "NCT01876511", "pmid": 26028255, "source_id": 147, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa1500596" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 817, "context": "Advanced", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to pembrolizumab for the treatment of adult and pediatric patients with unresectable or metastatic, microsatellite instability-high (MSI-H) or mismatch repair deficient colorectal ca", "disease": "Endometrial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "microsatellite_stability", "status": "MSI-High" } ], "feature_id": 817, "feature_type": "microsatellite_stability" } ], "last_updated": "2022-07-07", "oncotree_code": "UCEC", "oncotree_term": "Endometrial Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Merck Sharp & Dohme Corp. Keytruda (pembrolizumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/125514s110lbl.pdf. Revised March 2022. Accessed July 7, 2022.", "doi": "", "nct": "", "pmid": "", "source_id": 239, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/125514s110lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pembrolizumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 818, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A phase 1 trial observed antitumor activity in patients with ovarian cancer, prostate cancer, and breast cancer that were also carriers of BRCA1 or BRCA2 variants.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 818, "feature_type": "germline_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Fong, P. C. et al. Inhibition of poly(ADP-ribose) polymerase in tumors from BRCA mutation carriers. N. Engl. J. Med. 361, 123-134 (2009).", "doi": "10.1056/NEJMoa0900212", "nct": "NCT00516373", "pmid": 19553641, "source_id": 240, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa0900212" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 819, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A phase 1 trial observed antitumor activity in patients with ovarian cancer, prostate cancer, and breast cancer that were also carriers of BRCA1 or BRCA2 variants.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 819, "feature_type": "germline_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Fong, P. C. et al. Inhibition of poly(ADP-ribose) polymerase in tumors from BRCA mutation carriers. N. Engl. J. Med. 361, 123-134 (2009).", "doi": "10.1056/NEJMoa0900212", "nct": "NCT00516373", "pmid": 19553641, "source_id": 240, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa0900212" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 820, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A phase 1 trial observed antitumor activity in patients with ovarian cancer, prostate cancer, and breast cancer that were also carriers of BRCA1 or BRCA2 variants.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 820, "feature_type": "germline_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Fong, P. C. et al. Inhibition of poly(ADP-ribose) polymerase in tumors from BRCA mutation carriers. N. Engl. J. Med. 361, 123-134 (2009).", "doi": "10.1056/NEJMoa0900212", "nct": "NCT00516373", "pmid": 19553641, "source_id": 240, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa0900212" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 821, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A phase 1 trial observed antitumor activity in patients with ovarian cancer, prostate cancer, and breast cancer that were also carriers of BRCA1 or BRCA2 variants.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 821, "feature_type": "germline_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Fong, P. C. et al. Inhibition of poly(ADP-ribose) polymerase in tumors from BRCA mutation carriers. N. Engl. J. Med. 361, 123-134 (2009).", "doi": "10.1056/NEJMoa0900212", "nct": "NCT00516373", "pmid": 19553641, "source_id": 240, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa0900212" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 822, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A phase 1 trial observed antitumor activity in patients with ovarian cancer, prostate cancer, and breast cancer that were also carriers of BRCA1 or BRCA2 variants.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 822, "feature_type": "germline_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Fong, P. C. et al. Inhibition of poly(ADP-ribose) polymerase in tumors from BRCA mutation carriers. N. Engl. J. Med. 361, 123-134 (2009).", "doi": "10.1056/NEJMoa0900212", "nct": "NCT00516373", "pmid": 19553641, "source_id": 240, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa0900212" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 823, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A phase 1 trial observed antitumor activity in patients with ovarian cancer, prostate cancer, and breast cancer that were also carriers of BRCA1 or BRCA2 variants.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 823, "feature_type": "germline_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "Clinical trial", "sources": [ { "citation": "Fong, P. C. et al. Inhibition of poly(ADP-ribose) polymerase in tumors from BRCA mutation carriers. N. Engl. J. Med. 361, 123-134 (2009).", "doi": "10.1056/NEJMoa0900212", "nct": "NCT00516373", "pmid": 19553641, "source_id": 240, "source_type": "Journal", "url": "https://doi.org/10.1056/NEJMoa0900212" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 824, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Knockout of RB1 in a BRCA2 null LNCaP cells exhibited resistance to CDK4/6 inhibition with palbociclib.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "knockdown", "gene": "RB1", "technique": "shRNA" } ], "feature_id": 824, "feature_type": "knockdown" } ], "last_updated": "2023-10-05", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Chakraborty G, Armenia J, Mazzu YZ, et al. Significance of BRCA2 and RB1 Co-loss in Aggressive Prostate Cancer Progression. Clin Cancer Res. 2020;26(8):2047-2064.", "doi": "10.1158/1078-0432.CCR-19-1570", "nct": "", "pmid": 31796516, "source_id": 241, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-19-1570" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Palbociclib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "CDK4/6 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 825, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Silencing USP11 in human bone osteosarcoma epithelial cells (U2OS line) with siRNA led to spontaneous DDR activation and hypersensitivity to PARP inhibition, ionizing radiation, and other genotoxic stress agents.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "knockdown", "gene": "USP11", "technique": "siRNA" } ], "feature_id": 825, "feature_type": "knockdown" } ], "last_updated": "2022-08-04", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Wiltshire TD, Lovejoy CA, Wang T, Xia F, O'Connor MJ, Cortez D. Sensitivity to poly(ADP-ribose) polymerase (PARP) inhibition identifies ubiquitin-specific peptidase 11 (USP11) as a regulator of DNA double-strand break repair. J Biol Chem. 2010;285(19):14565-14571.", "doi": "10.1074/jbc.M110.104745", "nct": "", "pmid": 20233726, "source_id": 242, "source_type": "Journal", "url": "https://doi.org/10.1074/jbc.M110.104745" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 826, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to crizotinib for the treatment of adult and pediatric patients 1 year of age or older with unresectable, recurrent, or refactory inflammatory anaplastic lymphoma kinase (ALK)-positive myofibroblastic tumors (IMT).", "disease": "Inflammatory Myofibroblastic Tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ALK", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 826, "feature_type": "rearrangement" } ], "last_updated": "2024-03-04", "oncotree_code": "IMT", "oncotree_term": "Inflammatory Myofibroblastic Tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Xalkori (crizotinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/202570s033lbl.pdf. Revised July 2022. Accessed August 4th, 2022.", "doi": "", "nct": "", "pmid": "", "source_id": 243, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/202570s033lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Crizotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 827, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss-of-function of either BRCA1 or BRCA2 resulted in sensitization to PARP inhibition in both embryonic stem (ES) cells and nude mice lacking wild-type BRCA1 or BRCA2.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 827, "feature_type": "somatic_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Farmer, H. et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917-921 (2005).", "doi": "10.1038/nature03445", "nct": "", "pmid": 15829967, "source_id": 244, "source_type": "Journal", "url": "https://doi.org/10.1038/nature03445" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "KU0058684", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 828, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss-of-function of either BRCA1 or BRCA2 resulted in sensitization to PARP inhibition in both embryonic stem (ES) cells and nude mice lacking wild-type BRCA1 or BRCA2.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 828, "feature_type": "somatic_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Farmer, H. et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917-921 (2005).", "doi": "10.1038/nature03445", "nct": "", "pmid": 15829967, "source_id": 244, "source_type": "Journal", "url": "https://doi.org/10.1038/nature03445" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "KU0058684", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 829, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss-of-function of either BRCA1 or BRCA2 resulted in sensitization to PARP inhibition in both embryonic stem (ES) cells and nude mice lacking wild-type BRCA1 or BRCA2.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 829, "feature_type": "somatic_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Farmer, H. et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917-921 (2005).", "doi": "10.1038/nature03445", "nct": "", "pmid": 15829967, "source_id": 244, "source_type": "Journal", "url": "https://doi.org/10.1038/nature03445" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "KU0058948", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 830, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss-of-function of either BRCA1 or BRCA2 resulted in sensitization to PARP inhibition in both embryonic stem (ES) cells and nude mice lacking wild-type BRCA1 or BRCA2.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 830, "feature_type": "somatic_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Farmer, H. et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917-921 (2005).", "doi": "10.1038/nature03445", "nct": "", "pmid": 15829967, "source_id": 244, "source_type": "Journal", "url": "https://doi.org/10.1038/nature03445" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "KU0058948", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 831, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss-of-function of either BRCA1 or BRCA2 resulted in sensitization to PARP inhibition in both embryonic stem (ES) cells and nude mice lacking wild-type BRCA1 or BRCA2.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 831, "feature_type": "somatic_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Farmer, H. et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917-921 (2005).", "doi": "10.1038/nature03445", "nct": "", "pmid": 15829967, "source_id": 244, "source_type": "Journal", "url": "https://doi.org/10.1038/nature03445" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "KU0058948", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 832, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss-of-function of either BRCA1 or BRCA2 resulted in sensitization to PARP inhibition in both embryonic stem (ES) cells and nude mice lacking wild-type BRCA1 or BRCA2.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 832, "feature_type": "somatic_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Farmer, H. et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917-921 (2005).", "doi": "10.1038/nature03445", "nct": "", "pmid": 15829967, "source_id": 244, "source_type": "Journal", "url": "https://doi.org/10.1038/nature03445" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "KU0058948", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 833, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss-of-function of either BRCA1 or BRCA2 resulted in sensitization to PARP inhibition in both embryonic stem (ES) cells and nude mice lacking wild-type BRCA1 or BRCA2.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 833, "feature_type": "somatic_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Farmer, H. et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917-921 (2005).", "doi": "10.1038/nature03445", "nct": "", "pmid": 15829967, "source_id": 244, "source_type": "Journal", "url": "https://doi.org/10.1038/nature03445" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "KU0058684", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 834, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss-of-function of either BRCA1 or BRCA2 resulted in sensitization to PARP inhibition in both embryonic stem (ES) cells and nude mice lacking wild-type BRCA1 or BRCA2.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 834, "feature_type": "somatic_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Farmer, H. et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917-921 (2005).", "doi": "10.1038/nature03445", "nct": "", "pmid": 15829967, "source_id": 244, "source_type": "Journal", "url": "https://doi.org/10.1038/nature03445" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "KU0058684", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 835, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Four patients with uterine leiomyosarcoma and functional BRCA2 loss were evaluated for response to PARP inhibition with olaparib and all patients observed a durable response.", "disease": "Uterine Leiomyosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 835, "feature_type": "somatic_variant" } ], "last_updated": "2023-10-31", "oncotree_code": "ULMS", "oncotree_term": "Uterine Leiomyosarcoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Seligson ND, Kautto EA, Passen EN, et al. BRCA1/2 Functional Loss Defines a Targetable Subset in Leiomyosarcoma. Oncologist. 2019;24(7):973-979.", "doi": "10.1634/theoncologist.2018-0448", "nct": "", "pmid": 30541756, "source_id": 245, "source_type": "Journal", "url": "https://doi.org/10.1634/theoncologist.2018-0448" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 836, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Four patients with uterine leiomyosarcoma and functional BRCA2 loss were evaluated for response to PARP inhibition with olaparib and all patients observed a durable response.", "disease": "Uterine Leiomyosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 836, "feature_type": "somatic_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "ULMS", "oncotree_term": "Uterine Leiomyosarcoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Seligson ND, Kautto EA, Passen EN, et al. BRCA1/2 Functional Loss Defines a Targetable Subset in Leiomyosarcoma. Oncologist. 2019;24(7):973-979.", "doi": "10.1634/theoncologist.2018-0448", "nct": "", "pmid": 30541756, "source_id": 245, "source_type": "Journal", "url": "https://doi.org/10.1634/theoncologist.2018-0448" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 837, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In a preclinical setting, treatment of PARP inhibition using olaparib and talazoparib caused more cell growth inhibition in LNCaP cells harboring both BRCA2 and RB1 variants than those only harboring BRCA2 variants.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RB1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 837, "feature_type": "somatic_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Chakraborty G, Armenia J, Mazzu YZ, et al. Significance of BRCA2 and RB1 Co-loss in Aggressive Prostate Cancer Progression. Clin Cancer Res. 2020;26(8):2047-2064.", "doi": "10.1158/1078-0432.CCR-19-1570", "nct": "", "pmid": 31796516, "source_id": 241, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-19-1570" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib + Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 838, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In a preclinical setting, treatment of PARP inhibition using olaparib and talazoparib caused more cell growth inhibition in LNCaP cells harboring both BRCA2 and RB1 variants than those only harboring BRCA2 variants.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RB1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 838, "feature_type": "somatic_variant" } ], "last_updated": "2022-08-04", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Chakraborty G, Armenia J, Mazzu YZ, et al. Significance of BRCA2 and RB1 Co-loss in Aggressive Prostate Cancer Progression. Clin Cancer Res. 2020;26(8):2047-2064.", "doi": "10.1158/1078-0432.CCR-19-1570", "nct": "", "pmid": 31796516, "source_id": 241, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-19-1570" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib + Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 839, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss of ARTX expression was associated with poor differentiation, which was associated with poor overall survival in univariate analysis in a study of 86 patients with leiomyosarcoma.", "disease": "Leiomyosarcoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "ATRX" } ], "feature_id": 839, "feature_type": "copy_number" } ], "last_updated": "2022-08-04", "oncotree_code": "LMS", "oncotree_term": "Leiomyosarcoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Liau, J.-Y. et al. Leiomyosarcoma with alternative lengthening of telomeres is associated with aggressive histologic features, loss of ATRX expression, and poor clinical outcome. Am. J. Surg. Pathol. 39, 23644 (2015).", "doi": "10.1097/PAS.0000000000000324", "nct": "", "pmid": 25229770, "source_id": 246, "source_type": "Journal", "url": "https://doi.org/10.1097/PAS.0000000000000324" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 840, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss-of-function of either BRCA1 or BRCA2 resulted in sensitization to PARP inhibition in both embryonic stem (ES) cells and nude mice lacking wild-type BRCA1 or BRCA2.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "BRCA1" } ], "feature_id": 840, "feature_type": "copy_number" } ], "last_updated": "2022-08-04", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Farmer, H. et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917-921 (2005).", "doi": "10.1038/nature03445", "nct": "", "pmid": 15829967, "source_id": 244, "source_type": "Journal", "url": "https://doi.org/10.1038/nature03445" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "KU0058684", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 841, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss-of-function of either BRCA1 or BRCA2 resulted in sensitization to PARP inhibition in both embryonic stem (ES) cells and nude mice lacking wild-type BRCA1 or BRCA2.", "disease": "Ovarian Cancer, Other", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "BRCA2" } ], "feature_id": 841, "feature_type": "copy_number" } ], "last_updated": "2022-08-04", "oncotree_code": "OOVC", "oncotree_term": "Ovarian Cancer, Other", "predictive_implication": "Inferential", "sources": [ { "citation": "Farmer, H. et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917-921 (2005).", "doi": "10.1038/nature03445", "nct": "", "pmid": 15829967, "source_id": 244, "source_type": "Journal", "url": "https://doi.org/10.1038/nature03445" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "KU0058948", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 842, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Four patients with uterine leiomyosarcoma and functional BRCA2 loss were evaluated for response to PARP inhibition with olaparib and all patients observed a durable response.", "disease": "Uterine Leiomyosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "BRCA2" } ], "feature_id": 842, "feature_type": "copy_number" } ], "last_updated": "2022-08-04", "oncotree_code": "ULMS", "oncotree_term": "Uterine Leiomyosarcoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Seligson ND, Kautto EA, Passen EN, et al. BRCA1/2 Functional Loss Defines a Targetable Subset in Leiomyosarcoma. Oncologist. 2019;24(7):973-979.", "doi": "10.1634/theoncologist.2018-0448", "nct": "", "pmid": 30541756, "source_id": 245, "source_type": "Journal", "url": "https://doi.org/10.1634/theoncologist.2018-0448" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 843, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "A patient with uterine leiomyosarcoma whose tumor harbored a CDKN2A mutant which inactivated p16INK4a experienced clinical benefit from treatment with palbociclib.", "disease": "Uterine Leiomyosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "CDKN2A" } ], "feature_id": 843, "feature_type": "copy_number" } ], "last_updated": "2022-08-04", "oncotree_code": "ULMS", "oncotree_term": "Uterine Leiomyosarcoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Elvin JA, Gay LM, Ort R, et al. Clinical Benefit in Response to Palbociclib Treatment in Refractory Uterine Leiomyosarcomas with a Common CDKN2A Alteration. Oncologist. 2017;22(4):416-421.", "doi": "10.1634/theoncologist.2016-0310", "nct": "", "pmid": 28283584, "source_id": 247, "source_type": "Journal", "url": "https://doi.org/10.1634/theoncologist.2016-0310" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Palbociclib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CDK4/6 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 844, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Deletion of CDKN2C may sensitize tumors of patients with uterine leiomyosarcoma to CDK4/6 inhibition.", "disease": "Uterine Leiomyosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "CDKN2C" } ], "feature_id": 844, "feature_type": "copy_number" } ], "last_updated": "2022-08-04", "oncotree_code": "ULMS", "oncotree_term": "Uterine Leiomyosarcoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Williams EA, Sharaf R, Decker B, et al. CDKN2C-Null Leiomyosarcoma: A Novel, Genomically Distinct Class of TP53/RB1-Wild-Type Tumor With Frequent CIC Genomic Alterations and 1p/19q-Codeletion. JCO Precis Oncol. 2020;4.", "doi": "10.1200/PO.20.00040", "nct": "", "pmid": 28283584, "source_id": 248, "source_type": "Journal", "url": "https://doi.org/10.1200/PO.20.00040" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Palbociclib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CDK4/6 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 845, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Overexpression of MAPK7 and MAP2K4 were significantly associated with poor response to chemotherapy, tumor progression, and worse survival in a study of 30 patients.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "MAP2K4" } ], "feature_id": 845, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Tesser-Gamba, F. et al. MAPK7 and MAP2K4 as prognostic markers in osteosarcoma. Hum. Pathol. 43, 994-1002 (2012).", "doi": "10.1016/j.humpath.2011.08.003", "nct": "", "pmid": 22154052, "source_id": 249, "source_type": "Journal", "url": "https://doi.org/10.1016/j.humpath.2011.08.003" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Chemotherapy", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "Chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 846, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Overexpression of MAPK7 and MAP2K4 were significantly associated with poor response to chemotherapy, tumor progression, and worse survival in a study of 30 patients.", "disease": "Osteosarcoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "MAP2K4" } ], "feature_id": 846, "feature_type": "copy_number" } ], "last_updated": "2025-01-08", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Tesser-Gamba, F. et al. MAPK7 and MAP2K4 as prognostic markers in osteosarcoma. Hum. Pathol. 43, 994-1002 (2012).", "doi": "10.1016/j.humpath.2011.08.003", "nct": "", "pmid": 22154052, "source_id": 249, "source_type": "Journal", "url": "https://doi.org/10.1016/j.humpath.2011.08.003" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 847, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Overexpression of MAPK7 and MAP2K4 were significantly associated with poor response to chemotherapy, tumor progression, and worse survival in a study of 30 patients.", "disease": "Osteosarcoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "MAP2K4" } ], "feature_id": 847, "feature_type": "copy_number" } ], "last_updated": "2025-01-08", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Tesser-Gamba, F. et al. MAPK7 and MAP2K4 as prognostic markers in osteosarcoma. Hum. Pathol. 43, 994-1002 (2012).", "doi": "10.1016/j.humpath.2011.08.003", "nct": "", "pmid": 22154052, "source_id": 249, "source_type": "Journal", "url": "https://doi.org/10.1016/j.humpath.2011.08.003" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 848, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Overexpression of MAPK7 and MAP2K4 were significantly associated with poor response to chemotherapy, tumor progression, and worse survival in a study of 30 patients.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "MAPK7" } ], "feature_id": 848, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Tesser-Gamba, F. et al. MAPK7 and MAP2K4 as prognostic markers in osteosarcoma. Hum. Pathol. 43, 994-1002 (2012).", "doi": "10.1016/j.humpath.2011.08.003", "nct": "", "pmid": 22154052, "source_id": 249, "source_type": "Journal", "url": "https://doi.org/10.1016/j.humpath.2011.08.003" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Chemotherapy", "therapy_resistance": "", "therapy_sensitivity": 0, "therapy_strategy": "Chemotherapy", "therapy_type": "Chemotherapy", "validated": true }, { "assertion_id": 849, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "MYOCD was observed to be highly amplified and overexpressed in human retroperitoneal leiomyosarcomas (LMS) and, furthermore, that human retroperitoneal LMS differentiation is dependent on MYOCD amplification and overexpression.", "disease": "Leiomyosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "MYOCD" } ], "feature_id": 849, "feature_type": "copy_number" } ], "last_updated": "2022-08-04", "oncotree_code": "LMS", "oncotree_term": "Leiomyosarcoma", "predictive_implication": "Clinical evidence", "sources": [ { "citation": "Perot, G. et al. Strong smooth muscle differentiation is dependent on myocardin gene amplification in most human retroperitoneal leiomyosarcomas. Cancer Res. 69, 2269-2278 (2009).", "doi": "10.1158/0008-5472.CAN-08-1443", "nct": "", "pmid": 19276386, "source_id": 250, "source_type": "Journal", "url": "https://doi.org/10.1158/0008-5472.CAN-08-1443" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 850, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Overexpression of PDGFR alpha was observed to have an association with lymph node metastasis, suggesting an unfavorable phenotype, in a study of 181 tumor samples of invasive ductal breast carcinomas.", "disease": "Breast Invasive Ductal Carcinoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "PDGFRA" } ], "feature_id": 850, "feature_type": "copy_number" } ], "last_updated": "2022-08-04", "oncotree_code": "BRCA", "oncotree_term": "Breast Invasive Ductal Carcinoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Carvalho I, Milanezi F, Martins A, Reis RM, Schmitt F. Overexpression of platelet-derived growth factor receptor alpha in breast cancer is associated with tumour progression. Breast Cancer Res. 2005;7(5):R788-R795.", "doi": "10.1186/bcr1304", "nct": "", "pmid": 16168125, "source_id": 251, "source_type": "Journal", "url": "https://doi.org/10.1186/bcr1304" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 851, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Loss of PTEN was correlated with shorter disease-specific survival but not overall survival in a study of 103 patients with uterine leiomyosarcoma.", "disease": "Uterine Leiomyosarcoma", "favorable_prognosis": 0, "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "PTEN" } ], "feature_id": 851, "feature_type": "copy_number" } ], "last_updated": "2022-08-04", "oncotree_code": "ULMS", "oncotree_term": "Uterine Leiomyosarcoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Cuppens, T. et al. Potential Targets' Analysis Reveals Dual PI3K/mTOR Pathway Inhibition as a Promising Therapeutic Strategy for Uterine Leiomyosarcomas-an ENITEC Group Initiative. Clin. Cancer Res. 23, 1274-1285 (2017).", "doi": "10.1158/1078-0432.CCR-16-2149", "nct": "", "pmid": 28232476, "source_id": 252, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-16-2149" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 852, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Expression of Phospho-S6 Ribosomal Protein was suggestive of response to dual PI3K/mTOR inhibition in patient-derived xenograph leiomyosarcoma models.", "disease": "Uterine Leiomyosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "PTEN" } ], "feature_id": 852, "feature_type": "copy_number" } ], "last_updated": "2022-08-04", "oncotree_code": "ULMS", "oncotree_term": "Uterine Leiomyosarcoma", "predictive_implication": "Inferential", "sources": [ { "citation": "Cuppens, T. et al. Potential Targets' Analysis Reveals Dual PI3K/mTOR Pathway Inhibition as a Promising Therapeutic Strategy for Uterine Leiomyosarcomas-an ENITEC Group Initiative. Clin. Cancer Res. 23, 1274-1285 (2017).", "doi": "10.1158/1078-0432.CCR-16-2149", "nct": "", "pmid": 28232476, "source_id": 252, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-16-2149" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Alpelisib + Sapanisertib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 853, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "In a preclinical setting, treatment of PARP inhibition using olaparib and talazoparib caused more cell growth inhibition in LNCaP cells harboring both BRCA2 and RB1 variants than those only harboring BRCA2 variants.", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "RB1" } ], "feature_id": 853, "feature_type": "copy_number" } ], "last_updated": "2022-08-04", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Chakraborty G, Armenia J, Mazzu YZ, et al. Significance of BRCA2 and RB1 Co-loss in Aggressive Prostate Cancer Progression. Clin Cancer Res. 2020;26(8):2047-2064.", "doi": "10.1158/1078-0432.CCR-19-1570", "nct": "", "pmid": 31796516, "source_id": 241, "source_type": "Journal", "url": "https://doi.org/10.1158/1078-0432.CCR-19-1570" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib + Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 854, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) approved Pemazyre (pemigatinib) for adults with relapsed or refractory myeloid/lymphoid neoplasms (MLNs) with fibroblast growth factor 1 (FGFR1) rearrangements.", "disease": "Myeloid/Lymphoid Neoplasms", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "FGFR1", "gene2": null, "locus": null, "rearrangement_type": null } ], "feature_id": 854, "feature_type": "rearrangement" } ], "last_updated": "2022-09-08", "oncotree_code": "MLN", "oncotree_term": "Myeloid/Lymphoid Neoplasms", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Incyte Corporation. Pemazyre (pemigatinib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2022/213736s002lbl.pdf. Revised August 2022. Accessed September 8th, 2022.", "doi": "", "nct": "", "pmid": "", "source_id": 253, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/213736s002lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Pemigatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 855, "context": "locally advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted accelerated approval to Lytgobi (futibatinib) for the treatment of adult patients with previously treated, unresectable, locally advanced or metastatic intrahepatic cholangiocarcinoma harboring FGFR2 rearrangements.", "disease": "Intrahepatic Cholangiocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "FGFR2", "gene2": null, "locus": null, "rearrangement_type": null } ], "feature_id": 855, "feature_type": "rearrangement" } ], "last_updated": "2022-10-06", "oncotree_code": "IHCH", "oncotree_term": "Intrahepatic Cholangiocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Taiho Pharmaceutical Co., Ltd. Lytgobi (futibatinib) [package insert]. U.S. Food and Drug Administration website. www.accessdata.fda.gov/drugsatfda_docs/label/2022/214801s000lbl.pdf. Revised September 2022. Accessed October 6th, 2022.", "doi": "", "nct": "", "pmid": "", "source_id": 254, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/214801s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Futibatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 856, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted accelerated approval to Retevmo (selpercatinib) for the treatment of adult and pediatric patients 2 years of age and older with advanced or metastatic solid tumors with a RET gene fusion, as detected by an FDA-approved test, that have progressed on or following prior systemic treatment or who have no satisfactory alterantive treatment options. This indication was approved for adult patients on 2022-09-21 and pediatric patients on 2024-05-29.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "RET", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 856, "feature_type": "rearrangement" } ], "last_updated": "2025-02-13", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Eli Lily and Company. Retevmo (selpercatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/213246s012lbl.pdf. Revised May 2024. Accessed June 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 255, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/213246s012lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Selpercatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 857, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to Rezlidhia (olutasidenib) for the treatment of adult patients with relapsed or refractory acute myeloid leukemia (AML) with a susceptible IDH1 mutation as detected by an FDA-approved test.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.394C>T", "chromosome": "2", "end_position": "209113113", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132C", "reference_allele": "G", "rsid": "rs121913499", "start_position": "209113113", "variant_annotation": "Missense" } ], "feature_id": 857, "feature_type": "somatic_variant" } ], "last_updated": "2023-01-05", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Metrics Contract Services. Rezlidhia (olutasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/215814s000lbl.pdf. Revised December 2022. Accessed January 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 256, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/215814s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olutasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 858, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to Rezlidhia (olutasidenib) for the treatment of adult patients with relapsed or refractory acute myeloid leukemia (AML) with a susceptible IDH1 mutation as detected by an FDA-approved test.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.395G>A", "chromosome": "2", "end_position": "209113112", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132H", "reference_allele": "C", "rsid": "rs121913500", "start_position": "209113112", "variant_annotation": "Missense" } ], "feature_id": 858, "feature_type": "somatic_variant" } ], "last_updated": "2023-01-05", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Metrics Contract Services. Rezlidhia (olutasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/215814s000lbl.pdf. Revised December 2022. Accessed January 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 256, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/215814s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olutasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 859, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to Rezlidhia (olutasidenib) for the treatment of adult patients with relapsed or refractory acute myeloid leukemia (AML) with a susceptible IDH1 mutation as detected by an FDA-approved test.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.394C>G", "chromosome": "2", "end_position": "209113113", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132G", "reference_allele": "G", "rsid": "rs121913499", "start_position": "209113113", "variant_annotation": "Missense" } ], "feature_id": 859, "feature_type": "somatic_variant" } ], "last_updated": "2023-01-05", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Metrics Contract Services. Rezlidhia (olutasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/215814s000lbl.pdf. Revised December 2022. Accessed January 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 256, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/215814s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olutasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 860, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to Rezlidhia (olutasidenib) for the treatment of adult patients with relapsed or refractory acute myeloid leukemia (AML) with a susceptible IDH1 mutation as detected by an FDA-approved test.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.394C>A", "chromosome": "2", "end_position": "209113113", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132S", "reference_allele": "G", "rsid": "rs121913499", "start_position": "209113113", "variant_annotation": "Missense" } ], "feature_id": 860, "feature_type": "somatic_variant" } ], "last_updated": "2023-01-05", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Metrics Contract Services. Rezlidhia (olutasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/215814s000lbl.pdf. Revised December 2022. Accessed January 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 256, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/215814s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olutasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 861, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to Rezlidhia (olutasidenib) for the treatment of adult patients with relapsed or refractory acute myeloid leukemia (AML) with a susceptible IDH1 mutation as detected by an FDA-approved test.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.395G>T", "chromosome": "2", "end_position": "209113112", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132L", "reference_allele": "C", "rsid": "rs121913500", "start_position": "209113112", "variant_annotation": "Missense" } ], "feature_id": 861, "feature_type": "somatic_variant" } ], "last_updated": "2023-01-05", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Metrics Contract Services. Rezlidhia (olutasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/215814s000lbl.pdf. Revised December 2022. Accessed January 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 256, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/215814s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olutasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 862, "context": "Locally advanced or metastatic disease", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to adagrasib for adult patients with KRAS G12C mutated locally advanced or metastatic non-small cell lung cancer (NSCLC), as determined by an FDA approved test, who have received at least one prior systemic therapy.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.34G>T", "chromosome": "12", "end_position": "25398285", "exon": "2", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": "p.G12C", "reference_allele": "C", "rsid": "rs121913530", "start_position": "25398285", "variant_annotation": "Missense" } ], "feature_id": 862, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-30", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Mirati Therapeutics, Inc. Krazati (adagrasib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/216340Orig1s000Corrected_lbl.pdf. Revised Dec 2022. Accessed January 5th, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 257, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2022/216340Orig1s000Corrected_lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Adagrasib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RAS inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 863, "context": "Unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted accelerated approval to tucatinib in combination with trastuzumab for the treatment of adult patients with RAS wild-type HER2-positive unresectable or metastatic colorectal cancer that has progressed following treatment with fluoropyrimidine-, oxaliplatin-, and irinotecan-based chemotherapy.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 863, "feature_type": "copy_number" } ], "last_updated": "2023-02-02", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Seagen, Inc. Tukysa (tucatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/213411s004lbl.pdf. Revised January 2023. Accessed February 2, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 258, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/213411s004lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Trastuzumab + Tucatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 864, "context": "Advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to elacestrant for the treatment of postmenopausal women or adult men with ER-positive, HER2-negative, ESR1-mutated advanced or metastatic breast cancer with disease progression following at least one line of endocrine therapy.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "6", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ESR1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 864, "feature_type": "somatic_variant" } ], "last_updated": "2023-02-02", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Stemline Therapeutics, Inc. Orserdu (elacestrant) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/217639s000lbl.pdf. Revised January 2023. Accessed February 2, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 259, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/217639s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Elacestrant", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition", "therapy_type": "Hormone therapy", "validated": true }, { "assertion_id": 865, "context": "Unresectable or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to dabrafenib in combination with trametinib for the treament of pediatric patients 1 year of age or older with low-grade glioma (LGG) with a BRAF V600E mutation who require systemic therapy.", "disease": "Low-Grade Glioma, NOS", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 865, "feature_type": "somatic_variant" } ], "last_updated": "2023-04-06", "oncotree_code": "LGGNOS", "oncotree_term": "Low-Grade Glioma, NOS", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Tafinlar (dabrafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/202806s025lbl.pdf. Revised March 2023. Accessed April 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 260, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/202806s025lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dabrafenib + Trametinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition + MEK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 866, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to olaparib in combination with abiraterone and prednisone or prednisolone for the treatment of adult patients with deleterious or suspected deleterious BRCA-mutated (BRCAm) metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 866, "feature_type": "somatic_variant" } ], "last_updated": "2023-07-05", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf. Revised May 2023. Accessed July 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 172, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone + Olaparib + Prednisone", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + Corticosteroid + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 867, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to olaparib in combination with abiraterone and prednisone or prednisolone for the treatment of adult patients with deleterious or suspected deleterious BRCA-mutated (BRCAm) metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 867, "feature_type": "somatic_variant" } ], "last_updated": "2025-01-08", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf. Revised May 2023. Accessed July 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 172, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone + Olaparib + Prednisone", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + Corticosteroid + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 868, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to olaparib in combination with abiraterone and prednisone or prednisolone for the treatment of adult patients with deleterious or suspected deleterious BRCA-mutated (BRCAm) metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 868, "feature_type": "germline_variant" } ], "last_updated": "2023-07-05", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf. Revised May 2023. Accessed July 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 172, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone + Olaparib + Prednisone", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + Corticosteroid + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 869, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to olaparib in combination with abiraterone and prednisone or prednisolone for the treatment of adult patients with deleterious or suspected deleterious BRCA-mutated (BRCAm) metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 869, "feature_type": "germline_variant" } ], "last_updated": "2023-07-05", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf. Revised May 2023. Accessed July 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 172, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone + Olaparib + Prednisone", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + Corticosteroid + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 870, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to olaparib for the maintenance treatment of adult patients with deleterious or suspected deleterious germline BRCA-mutated (gBRCAm) metastatic pancreatic adenocarcinoma whose disease has not progressed on at least 16 weeks of a first-line platinum-based chemotherapy regime.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 870, "feature_type": "germline_variant" } ], "last_updated": "2023-07-05", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf. Revised May 2023. Accessed July 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 172, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 871, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to olaparib for the maintenance treatment of adult patients with deleterious or suspected deleterious germline BRCA-mutated (gBRCAm) metastatic pancreatic adenocarcinoma whose disease has not progressed on at least 16 weeks of a first-line platinum-based chemotherapy regime.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 871, "feature_type": "germline_variant" } ], "last_updated": "2023-07-05", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf. Revised May 2023. Accessed July 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 172, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 872, "context": "HER2-negative high risk early breast cancer who have been treated with neoadjuvant or adjuvant chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for the treatment of adult patients with deleterious or suspected deleterious germline BRCA-mutated (gBRCAm) human epidermal growth factor receptor 2 (HER2)-negative high risk early breast cancer who have been treated with neoadjuvant or adjuvant chemotherapy.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 872, "feature_type": "germline_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf. Revised May 2023. Accessed July 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 172, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 873, "context": "HER2-negative high risk early breast cancer who have been treated with neoadjuvant or adjuvant chemotherapy", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to olaparib for the treatment of adult patients with deleterious or suspected deleterious germline BRCA-mutated (gBRCAm) human epidermal growth factor receptor 2 (HER2)-negative high risk early breast cancer who have been treated with neoadjuvant or adjuvant chemotherapy.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": "1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 873, "feature_type": "germline_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Lynparza (olaparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf. Revised May 2023. Accessed July 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 172, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/208558s025lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 874, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to talazoparib in combination with enzalutamide for the treatment of adult patients with HRR gene-mutated metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ATM", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 874, "feature_type": "somatic_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Talzenna (talazoparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf. Revised June 2023. Accessed July 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 261, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enzalutamide + Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 875, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to talazoparib in combination with enzalutamide for the treatment of adult patients with HRR gene-mutated metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "ATR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 875, "feature_type": "somatic_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Talzenna (talazoparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf. Revised June 2023. Accessed July 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 261, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enzalutamide + Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 876, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to talazoparib in combination with enzalutamide for the treatment of adult patients with HRR gene-mutated metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 876, "feature_type": "somatic_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Talzenna (talazoparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf. Revised June 2023. Accessed July 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 261, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enzalutamide + Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 877, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to talazoparib in combination with enzalutamide for the treatment of adult patients with HRR gene-mutated metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 877, "feature_type": "somatic_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Talzenna (talazoparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf. Revised June 2023. Accessed July 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 261, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enzalutamide + Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 878, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to talazoparib in combination with enzalutamide for the treatment of adult patients with HRR gene-mutated metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CDK12", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 878, "feature_type": "somatic_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Talzenna (talazoparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf. Revised June 2023. Accessed July 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 261, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enzalutamide + Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 879, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to talazoparib in combination with enzalutamide for the treatment of adult patients with HRR gene-mutated metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "CHEK2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 879, "feature_type": "somatic_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Talzenna (talazoparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf. Revised June 2023. Accessed July 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 261, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enzalutamide + Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 880, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to talazoparib in combination with enzalutamide for the treatment of adult patients with HRR gene-mutated metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "FANCA", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 880, "feature_type": "somatic_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Talzenna (talazoparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf. Revised June 2023. Accessed July 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 261, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enzalutamide + Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 881, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to talazoparib in combination with enzalutamide for the treatment of adult patients with HRR gene-mutated metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "MLH1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 881, "feature_type": "somatic_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Talzenna (talazoparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf. Revised June 2023. Accessed July 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 261, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enzalutamide + Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 883, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to talazoparib in combination with enzalutamide for the treatment of adult patients with HRR gene-mutated metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "NBN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 883, "feature_type": "somatic_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Talzenna (talazoparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf. Revised June 2023. Accessed July 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 261, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enzalutamide + Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 884, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to talazoparib in combination with enzalutamide for the treatment of adult patients with HRR gene-mutated metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PALB2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 884, "feature_type": "somatic_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Talzenna (talazoparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf. Revised June 2023. Accessed July 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 261, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enzalutamide + Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 885, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to talazoparib in combination with enzalutamide for the treatment of adult patients with HRR gene-mutated metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RAD51C", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 885, "feature_type": "somatic_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Talzenna (talazoparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf. Revised June 2023. Accessed July 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 261, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enzalutamide + Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 886, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to niraparib, a poly (ADP-ribose) polymerase (PARP) inhibitor, and abiraterone acetate, a CYP17 inhibitor indicated with prednisone for the treatment of adult patients with deleterious or suspected deleterious BRCA-mutated (BRCAm) metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA1", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 886, "feature_type": "germline_variant" } ], "last_updated": "2023-09-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Janssen Biotech, Inc. Akeega (niraparib and abiraterone acetate) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/216793s000lbl.pdf. Revised August 2023. Accessed September 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 262, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/216793s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone acetate + Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 887, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to niraparib, a poly (ADP-ribose) polymerase (PARP) inhibitor, and abiraterone acetate, a CYP17 inhibitor indicated with prednisone for the treatment of adult patients with deleterious or suspected deleterious BRCA-mutated (BRCAm) metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 887, "feature_type": "somatic_variant" } ], "last_updated": "2023-09-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Janssen Biotech, Inc. Akeega (niraparib and abiraterone acetate) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/216793s000lbl.pdf. Revised August 2023. Accessed September 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 262, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/216793s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone acetate + Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 888, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to niraparib, a poly (ADP-ribose) polymerase (PARP) inhibitor, and abiraterone acetate, a CYP17 inhibitor indicated with prednisone for the treatment of adult patients with deleterious or suspected deleterious BRCA-mutated (BRCAm) metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "germline_variant", "gene": "BRCA2", "pathogenic": null, "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 888, "feature_type": "germline_variant" } ], "last_updated": "2023-09-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Janssen Biotech, Inc. Akeega (niraparib and abiraterone acetate) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/216793s000lbl.pdf. Revised August 2023. Accessed September 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 262, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/216793s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone acetate + Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 889, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to niraparib, a poly (ADP-ribose) polymerase (PARP) inhibitor, and abiraterone acetate, a CYP17 inhibitor indicated with prednisone for the treatment of adult patients with deleterious or suspected deleterious BRCA-mutated (BRCAm) metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "BRCA2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 889, "feature_type": "somatic_variant" } ], "last_updated": "2023-09-06", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Janssen Biotech, Inc. Akeega (niraparib and abiraterone acetate) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/216793s000lbl.pdf. Revised August 2023. Accessed September 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 262, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/216793s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Abiraterone acetate + Niraparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 890, "context": "Primary advanced or recurrent", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to dostarlimab-gxly in combination with carboplatin and paclitaxel, followed by single agent dostarlimab-gxly, for the treatment of adult patients primary advanced or recurrent endometrial cancer that is mismatch repair deficient (dMMR), as determined by an FDA-approved test, or microsatellite-instability-high.", "disease": "Endometrial Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "microsatellite_stability", "status": "MSI-High" } ], "feature_id": 890, "feature_type": "microsatellite_stability" } ], "last_updated": "2025-02-13", "oncotree_code": "UCEC", "oncotree_term": "Endometrial Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "GlaxoSmithKline LLC. Jemperli (dostarlimab-gxly) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/761174s006lbl.pdf. Revised July 2023. Accessed September 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 263, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/761174s006lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dostarlimab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PD-1/PD-L1 inhibition", "therapy_type": "Immunotherapy", "validated": true }, { "assertion_id": 891, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Two osteosarcoma cancer cell lines, KHOS and KHOSR2, were exposed to NSC59984 at concentrations ranging from 0.0001 - 100 micromolar for three days and cell viability significantly decreased after dosage of 10 and 20 micromolar for the two cell lines, respectively. NSC59984 restores TP53 pathway signaling via p73 activation and induces mutant TP53 degradation, mediated by the MDM2 proteasome pathway.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "TP53", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 891, "feature_type": "somatic_variant" } ], "last_updated": "2023-07-06", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Tang F, Min L, Seebacher NA, et al. Targeting mutant TP53 as a potential therapeutic strategy for the treatment of osteosarcoma. J Orthop Res. 2019;37(3):789-798.", "doi": "10.1002/jor.24227", "nct": "", "pmid": 30131505, "source_id": 264, "source_type": "Journal", "url": "https://onlinelibrary.wiley.com/doi/10.1002/jor.24227" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "NSC59984", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Mutant p53 degradation", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 892, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Eighteen osteosarcoma cancer cell lines were subject to drug screens of 17 compounds, from which mutant RB1 status was observed to be associated with resistance to palbociclib.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RB1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 892, "feature_type": "somatic_variant" } ], "last_updated": "2025-01-08", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Holme H, Gulati A, Brough R, et al. Chemosensitivity profiling of osteosarcoma tumour cell lines identifies a model of BRCAness. Sci Rep. 2018;8(1).", "doi": "10.1038/s41598-018-29043-z", "nct": "", "pmid": 30006631, "source_id": 265, "source_type": "Journal", "url": "https://www.nature.com/articles/s41598-018-29043-z" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Palbociclib", "therapy_resistance": 1, "therapy_sensitivity": "", "therapy_strategy": "CDK4/6 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 893, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Eighteen osteosarcoma cancer cell lines were subject to drug screens of 17 compounds. Three osteosarcoma cancer cell lines with FGFR1 amplified (G292, NOS1, and CAL72) and two with FGFR1 gains (HU09 and NY) were observed to be significantly more sensitive to AZ4547 and PD173074, both FGFR inhibitors, than cell lines without FGFR1 copy number alterations.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "FGFR1" } ], "feature_id": 893, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Holme H, Gulati A, Brough R, et al. Chemosensitivity profiling of osteosarcoma tumour cell lines identifies a model of BRCAness. Sci Rep. 2018;8(1).", "doi": "10.1038/s41598-018-29043-z", "nct": "", "pmid": 30006631, "source_id": 265, "source_type": "Journal", "url": "https://www.nature.com/articles/s41598-018-29043-z" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Fexagratinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 894, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Eighteen osteosarcoma cancer cell lines were subject to drug screens of 17 compounds. Three osteosarcoma cancer cell lines with FGFR1 amplified (G292, NOS1, and CAL72) and two with FGFR1 gains (HU09 and NY) were observed to be significantly more sensitive to AZ4547 and PD173074, both FGFR inhibitors, than cell lines without FGFR1 copy number alterations.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "FGFR1" } ], "feature_id": 894, "feature_type": "copy_number" } ], "last_updated": "2025-01-08", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Holme H, Gulati A, Brough R, et al. Chemosensitivity profiling of osteosarcoma tumour cell lines identifies a model of BRCAness. Sci Rep. 2018;8(1).", "doi": "10.1038/s41598-018-29043-z", "nct": "", "pmid": 30006631, "source_id": 265, "source_type": "Journal", "url": "https://www.nature.com/articles/s41598-018-29043-z" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "PD173074", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "FGFR1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 895, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Sensitivity to olaparib was observed across a broad osteosarcoma-focused cell panel in RB1-mutant or RB1 expression lacking cell lines relative to RB1-normal lines. Similar results in this study were observed with niraparib and talazoparib. The study also observed that the single-agent sensitivity to PARP inhibition with RB1-defective osteosarcoma cells extended to a xenograft of an RB1-defective osteosarcoma line (OHSN) in immunodeficient NRG mice.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "RB1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 895, "feature_type": "somatic_variant" } ], "last_updated": "2025-01-08", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Zoumpoulidou G, Alvarez-Mendoza C, Mancusi C, et al. Therapeutic vulnerability to PARP1,2 inhibition in RB1-mutant osteosarcoma. Nat Commun. 2021;12(1).", "doi": "10.1038/s41467-021-27291-8", "nct": "", "pmid": 34862364, "source_id": 266, "source_type": "Journal", "url": "https://www.nature.com/articles/s41467-021-27291-8" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Olaparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 896, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Fifteen PDTX models were developed by directly grafting tumor samples from patients with osteosarcoma into immunocompromised mice. Treatment of both MYC-amplified PDTXs with CDK inhibitor AT7519 resulted in decreased tumor growth and levels of MYC protein and MYC target MCL1 were significantly reduced following treatment.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "MYC" } ], "feature_id": 896, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Sayles LC, Breese MR, Koehne AL, et al. Genome-Informed Targeted Therapy for Osteosarcoma. Cancer Discovery. 2019;9(1):46-63.", "doi": "10.1158/2159-8290.CD-17-1152", "nct": "", "pmid": 30266815, "source_id": 267, "source_type": "Journal", "url": "https://aacrjournals.org/cancerdiscovery/article/9/1/46/10398/Genome-Informed-Targeted-Therapy-for" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "CDK Inhibitor AT7519", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CDK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 897, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Fifteen PDTX models were developed by directly grafting tumor samples from patients with osteosarcoma into immunocompromised mice. Treatment of three CCNE1-amplified PDTX models resulted in significant inhibition of tumor growth. Furthermore, CC3 staining after short-term treatment confirmed a modest but statistically significant increase in apoptosis.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "CCNE1" } ], "feature_id": 897, "feature_type": "copy_number" } ], "last_updated": "2025-01-08", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Sayles LC, Breese MR, Koehne AL, et al. Genome-Informed Targeted Therapy for Osteosarcoma. Cancer Discovery. 2019;9(1):46-63.", "doi": "10.1158/2159-8290.CD-17-1152", "nct": "", "pmid": 30266815, "source_id": 267, "source_type": "Journal", "url": "https://aacrjournals.org/cancerdiscovery/article/9/1/46/10398/Genome-Informed-Targeted-Therapy-for" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dinaciclib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CDK1/2/5/9 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 898, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Fifteen PDTX models were developed by directly grafting tumor samples from patients with osteosarcoma into immunocompromised mice. Two models were identified to harbor CDK4 amplifications, both of which demonstrated increased CDK4 gene and protein expression. Treatment of these two models with palbociclib resulted in significant growth arrest relative to control vehicle.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "CDK4" } ], "feature_id": 898, "feature_type": "copy_number" } ], "last_updated": "2025-01-08", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Sayles LC, Breese MR, Koehne AL, et al. Genome-Informed Targeted Therapy for Osteosarcoma. Cancer Discovery. 2019;9(1):46-63.", "doi": "10.1158/2159-8290.CD-17-1152", "nct": "", "pmid": 30266815, "source_id": 267, "source_type": "Journal", "url": "https://aacrjournals.org/cancerdiscovery/article/9/1/46/10398/Genome-Informed-Targeted-Therapy-for" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Palbociclib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "CDK4/6 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 899, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Fifteen PDTX models were developed by directly grafting tumor samples from patients with osteosarcoma into immunocompromised mice. Two models were identified to harbor alterations within the PI3K/AKT/mTOR pathway, one with biallelic PTEN loss and one with amplification of AKT1. High levels of phosphorylation of ribosomal protein S6 was observed in both models. Both models were treated with MK-2660, a pan-AKT inhibitor, and observed significant reduction of tumor growth relative to control vehicle.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "PTEN" } ], "feature_id": 899, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Sayles LC, Breese MR, Koehne AL, et al. Genome-Informed Targeted Therapy for Osteosarcoma. Cancer Discovery. 2019;9(1):46-63.", "doi": "10.1158/2159-8290.CD-17-1152", "nct": "", "pmid": 30266815, "source_id": 267, "source_type": "Journal", "url": "https://aacrjournals.org/cancerdiscovery/article/9/1/46/10398/Genome-Informed-Targeted-Therapy-for" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Akt Inhibitor MK2206", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 900, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Fifteen PDTX models were developed by directly grafting tumor samples from patients with osteosarcoma into immunocompromised mice. Two models were identified to harbor alterations within the PI3K/AKT/mTOR pathway, one with biallelic PTEN loss and one with amplification of AKT1. High levels of phosphorylation of ribosomal protein S6 was observed in both models. Both models were treated with MK-2660, a pan-AKT inhibitor, and observed significant reduction of tumor growth relative to control vehicle. The PTEN-deficient model was also treated with rapamycin to inhibit mTOR and significant tumor growth decrease was also observed.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "PTEN" } ], "feature_id": 900, "feature_type": "copy_number" } ], "last_updated": "2025-02-13", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Sayles LC, Breese MR, Koehne AL, et al. Genome-Informed Targeted Therapy for Osteosarcoma. Cancer Discovery. 2019;9(1):46-63.", "doi": "10.1158/2159-8290.CD-17-1152", "nct": "", "pmid": 30266815, "source_id": 267, "source_type": "Journal", "url": "https://aacrjournals.org/cancerdiscovery/article/9/1/46/10398/Genome-Informed-Targeted-Therapy-for" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Sirolimus", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 901, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Response to talazoparib in osteosarcoma cell lines was associated with homologous recombination deficiency in a study of 5 cancer cell lines. Osteosarcoma cell lines MG63 and ZK-58 displayed the highest sensitivity to talazoparib, SaOS-2 and MNNG-HOS displayed intermediate sensitivity, and U2OS cells remained resistant. Cell lines MG63, ZK-58, and MNNG-HOS scored HRD-LOH positive according to a score (Abkevich et al. 2012). MG63 cells harbored copy losses in BAP1, FANCA, and FANCD2 while ZK-58 carried disruptive copy loss in BARD1 and copy gain in FANCD2. SaOS-2 cells harbored copy losses in CHEK2 and TP53 and MNNG-HOS cells have copy loss of ATM and disruptive copy gains in PTEN and FANCD2. The talazoparib-resistant cell line, U2OS, carried a heterozygous BRCA2 copy loss and one intact BRCA2 alelle.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "BAP1" } ], "feature_id": 901, "feature_type": "copy_number" } ], "last_updated": "2025-01-08", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Engert F, Kovac M, Baumhoer D, Nathrath M, Fulda S. Osteosarcoma cells with genetic signatures of BRCAness are susceptible to the PARP inhibitor talazoparib alone or in combination with chemotherapeutics. Oncotarget. 2016;8(30):48794-48806.", "doi": "10.18632/oncotarget.10720", "nct": "", "pmid": 27447864, "source_id": 268, "source_type": "Journal", "url": "https://www.clinicalkey.com/#!/content/playContent/1-s2.0-S1470204513700494" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 902, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Response to talazoparib in osteosarcoma cell lines was associated with homologous recombination deficiency in a study of 5 cancer cell lines. Osteosarcoma cell lines MG63 and ZK-58 displayed the highest sensitivity to talazoparib, SaOS-2 and MNNG-HOS displayed intermediate sensitivity, and U2OS cells remained resistant. Cell lines MG63, ZK-58, and MNNG-HOS scored HRD-LOH positive according to a score (Abkevich et al. 2012). MG63 cells harbored copy losses in BAP1, FANCA, and FANCD2 while ZK-58 carried disruptive copy loss in BARD1 and copy gain in FANCD2. SaOS-2 cells harbored copy losses in CHEK2 and TP53 and MNNG-HOS cells have copy loss of ATM and disruptive copy gains in PTEN and FANCD2. The talazoparib-resistant cell line, U2OS, carried a heterozygous BRCA2 copy loss and one intact BRCA2 alelle.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "FANCA" } ], "feature_id": 902, "feature_type": "copy_number" } ], "last_updated": "2025-01-08", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Engert F, Kovac M, Baumhoer D, Nathrath M, Fulda S. Osteosarcoma cells with genetic signatures of BRCAness are susceptible to the PARP inhibitor talazoparib alone or in combination with chemotherapeutics. Oncotarget. 2016;8(30):48794-48806.", "doi": "10.18632/oncotarget.10720", "nct": "", "pmid": 27447864, "source_id": 268, "source_type": "Journal", "url": "https://www.clinicalkey.com/#!/content/playContent/1-s2.0-S1470204513700494" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 903, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Response to talazoparib in osteosarcoma cell lines was associated with homologous recombination deficiency in a study of 5 cancer cell lines. Osteosarcoma cell lines MG63 and ZK-58 displayed the highest sensitivity to talazoparib, SaOS-2 and MNNG-HOS displayed intermediate sensitivity, and U2OS cells remained resistant. Cell lines MG63, ZK-58, and MNNG-HOS scored HRD-LOH positive according to a score (Abkevich et al. 2012). MG63 cells harbored copy losses in BAP1, FANCA, and FANCD2 while ZK-58 carried disruptive copy loss in BARD1 and copy gain in FANCD2. SaOS-2 cells harbored copy losses in CHEK2 and TP53 and MNNG-HOS cells have copy loss of ATM and disruptive copy gains in PTEN and FANCD2. The talazoparib-resistant cell line, U2OS, carried a heterozygous BRCA2 copy loss and one intact BRCA2 alelle.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "BARD1" } ], "feature_id": 903, "feature_type": "copy_number" } ], "last_updated": "2025-01-08", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Engert F, Kovac M, Baumhoer D, Nathrath M, Fulda S. Osteosarcoma cells with genetic signatures of BRCAness are susceptible to the PARP inhibitor talazoparib alone or in combination with chemotherapeutics. Oncotarget. 2016;8(30):48794-48806.", "doi": "10.18632/oncotarget.10720", "nct": "", "pmid": 27447864, "source_id": 268, "source_type": "Journal", "url": "https://www.clinicalkey.com/#!/content/playContent/1-s2.0-S1470204513700494" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 904, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Response to talazoparib in osteosarcoma cell lines was associated with homologous recombination deficiency in a study of 5 cancer cell lines. Osteosarcoma cell lines MG63 and ZK-58 displayed the highest sensitivity to talazoparib, SaOS-2 and MNNG-HOS displayed intermediate sensitivity, and U2OS cells remained resistant. Cell lines MG63, ZK-58, and MNNG-HOS scored HRD-LOH positive according to a score (Abkevich et al. 2012). MG63 cells harbored copy losses in BAP1, FANCA, and FANCD2 while ZK-58 carried disruptive copy loss in BARD1 and copy gain in FANCD2. SaOS-2 cells harbored copy losses in CHEK2 and TP53 and MNNG-HOS cells have copy loss of ATM and disruptive copy gains in PTEN and FANCD2. The talazoparib-resistant cell line, U2OS, carried a heterozygous BRCA2 copy loss and one intact BRCA2 alelle.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "CHEK2" } ], "feature_id": 904, "feature_type": "copy_number" } ], "last_updated": "2025-01-08", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Engert F, Kovac M, Baumhoer D, Nathrath M, Fulda S. Osteosarcoma cells with genetic signatures of BRCAness are susceptible to the PARP inhibitor talazoparib alone or in combination with chemotherapeutics. Oncotarget. 2016;8(30):48794-48806.", "doi": "10.18632/oncotarget.10720", "nct": "", "pmid": 27447864, "source_id": 268, "source_type": "Journal", "url": "https://www.clinicalkey.com/#!/content/playContent/1-s2.0-S1470204513700494" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 905, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Response to talazoparib in osteosarcoma cell lines was associated with homologous recombination deficiency in a study of 5 cancer cell lines. Osteosarcoma cell lines MG63 and ZK-58 displayed the highest sensitivity to talazoparib, SaOS-2 and MNNG-HOS displayed intermediate sensitivity, and U2OS cells remained resistant. Cell lines MG63, ZK-58, and MNNG-HOS scored HRD-LOH positive according to a score (Abkevich et al. 2012). MG63 cells harbored copy losses in BAP1, FANCA, and FANCD2 while ZK-58 carried disruptive copy loss in BARD1 and copy gain in FANCD2. SaOS-2 cells harbored copy losses in CHEK2 and TP53 and MNNG-HOS cells have copy loss of ATM and disruptive copy gains in PTEN and FANCD2. The talazoparib-resistant cell line, U2OS, carried a heterozygous BRCA2 copy loss and one intact BRCA2 alelle.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "TP53" } ], "feature_id": 905, "feature_type": "copy_number" } ], "last_updated": "2025-01-08", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Engert F, Kovac M, Baumhoer D, Nathrath M, Fulda S. Osteosarcoma cells with genetic signatures of BRCAness are susceptible to the PARP inhibitor talazoparib alone or in combination with chemotherapeutics. Oncotarget. 2016;8(30):48794-48806.", "doi": "10.18632/oncotarget.10720", "nct": "", "pmid": 27447864, "source_id": 268, "source_type": "Journal", "url": "https://www.clinicalkey.com/#!/content/playContent/1-s2.0-S1470204513700494" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 906, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "Response to talazoparib in osteosarcoma cell lines was associated with homologous recombination deficiency in a study of 5 cancer cell lines. Osteosarcoma cell lines MG63 and ZK-58 displayed the highest sensitivity to talazoparib, SaOS-2 and MNNG-HOS displayed intermediate sensitivity, and U2OS cells remained resistant. Cell lines MG63, ZK-58, and MNNG-HOS scored HRD-LOH positive according to a score (Abkevich et al. 2012). MG63 cells harbored copy losses in BAP1, FANCA, and FANCD2 while ZK-58 carried disruptive copy loss in BARD1 and copy gain in FANCD2. SaOS-2 cells harbored copy losses in CHEK2 and TP53 and MNNG-HOS cells have copy loss of ATM and disruptive copy gains in PTEN and FANCD2. The talazoparib-resistant cell line, U2OS, carried a heterozygous BRCA2 copy loss and one intact BRCA2 alelle.", "disease": "Osteosarcoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "ATM" } ], "feature_id": 906, "feature_type": "copy_number" } ], "last_updated": "2025-01-08", "oncotree_code": "OS", "oncotree_term": "Osteosarcoma", "predictive_implication": "Preclinical", "sources": [ { "citation": "Engert F, Kovac M, Baumhoer D, Nathrath M, Fulda S. Osteosarcoma cells with genetic signatures of BRCAness are susceptible to the PARP inhibitor talazoparib alone or in combination with chemotherapeutics. Oncotarget. 2016;8(30):48794-48806.", "doi": "10.18632/oncotarget.10720", "nct": "", "pmid": 27447864, "source_id": 268, "source_type": "Journal", "url": "https://www.clinicalkey.com/#!/content/playContent/1-s2.0-S1470204513700494" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PARP inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 907, "context": "Pediatric", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for bosutinib for pediatric patients 1 year of age or older with chronic phase Ph+ chronic myeloid leukemia (CML) that is newly diagnosed or resistant or intolerant to prior therapy.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BCR", "gene2": "ABL1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 907, "feature_type": "rearrangement" } ], "last_updated": "2023-11-01", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer Inc. Bosulif (bosutinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/203341s025lbl.pdf. Revised September 2023. Accessed November 1, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 269, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/203341s025lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Bosutinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "targets BCR-ABL", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 908, "context": "Relapsed or refractory", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration approved ivosidenib for adult patients with relapsed or refractory myelodysplastic syndromes (MDS) with a susceptible IDH1 mutation, as detected by an FDA-approved test.", "disease": "Myelodysplastic Syndromes", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "2", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 908, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-01", "oncotree_code": "MDS", "oncotree_term": "Myelodysplastic Syndromes", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Agios Pharmaceuticals, Inc.. Tibsovo (ivosidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211192s011lbl.pdf. Revised October 2023. Accessed November 1, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 270, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211192s011lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ivosidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 909, "context": "Relapsed or refractory", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration approved ivosidenib for adult patients with relapsed or refractory myelodysplastic syndromes (MDS) with a susceptible IDH1 mutation, as detected by an FDA-approved test.", "disease": "Myelodysplastic Syndromes", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.395G>A", "chromosome": "2", "end_position": "209113112", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132H", "reference_allele": "C", "rsid": "rs121913500", "start_position": "209113112", "variant_annotation": "Missense" } ], "feature_id": 909, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-01", "oncotree_code": "MDS", "oncotree_term": "Myelodysplastic Syndromes", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Agios Pharmaceuticals, Inc.. Tibsovo (ivosidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211192s011lbl.pdf. Revised October 2023. Accessed November 1, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 270, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211192s011lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ivosidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 910, "context": "Relapsed or refractory", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration approved ivosidenib for adult patients with relapsed or refractory myelodysplastic syndromes (MDS) with a susceptible IDH1 mutation, as detected by an FDA-approved test.", "disease": "Myelodysplastic Syndromes", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.394C>T", "chromosome": "2", "end_position": "209113113", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132C", "reference_allele": "G", "rsid": "rs121913499", "start_position": "209113113", "variant_annotation": "Missense" } ], "feature_id": 910, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-01", "oncotree_code": "MDS", "oncotree_term": "Myelodysplastic Syndromes", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Agios Pharmaceuticals, Inc.. Tibsovo (ivosidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211192s011lbl.pdf. Revised October 2023. Accessed November 1, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 270, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211192s011lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ivosidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 911, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) approved encorafenib in combination with binimetinib for the treatment of adult patients with metastatic non-small cell lung cancer (NSCLC) with BRAF V600E mutation, as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 911, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-01", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Array BioPharma Inc. Braftovi (encorafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/210496s014lbl.pdf. Revised October 2023. Accessed November 1, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 271, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/210496s014lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Binimetinib + Encorafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition + B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 912, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights FLT3 Internal Tandem Duplication and D835 missense codon changes as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2504A>C", "chromosome": "13", "end_position": "28592641", "exon": "20", "feature_type": "somatic_variant", "gene": "FLT3", "protein_change": "p.D835A", "reference_allele": "T", "rsid": "rs121909646", "start_position": "28592641", "variant_annotation": "Missense" } ], "feature_id": 912, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 913, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights FLT3 Internal Tandem Duplication and D835 missense codon changes as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2505T>A", "chromosome": "13", "end_position": "28592640", "exon": "20", "feature_type": "somatic_variant", "gene": "FLT3", "protein_change": "p.D835E", "reference_allele": "T", "rsid": "rs121913487", "start_position": "28592640", "variant_annotation": "Missense" } ], "feature_id": 913, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 914, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights FLT3 Internal Tandem Duplication and D835 missense codon changes as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2503G>C", "chromosome": "13", "end_position": "28592642", "exon": "20", "feature_type": "somatic_variant", "gene": "FLT3", "protein_change": "p.D835H", "reference_allele": "C", "rsid": "rs121913488", "start_position": "28592642", "variant_annotation": "Missense" } ], "feature_id": 914, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 915, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights FLT3 Internal Tandem Duplication and D835 missense codon changes as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.2503G>T", "chromosome": "13", "end_position": "28592642", "exon": "20", "feature_type": "somatic_variant", "gene": "FLT3", "protein_change": "p.D835Y", "reference_allele": "C", "rsid": "rs121913488", "start_position": "28592642", "variant_annotation": "Missense" } ], "feature_id": 915, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 916, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights GATA2 nonsense, frameshift, splice site, and missense codon changes in codons 349 - 398 as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "3", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "FLT3", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Missense" } ], "feature_id": 916, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 917, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights GATA2 nonsense, frameshift, splice site, and missense codon changes in codons 349 - 398 as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "3", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "FLT3", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 917, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 918, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights GATA2 nonsense, frameshift, splice site, and missense codon changes in codons 349 - 398 as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "3", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "FLT3", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 918, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 919, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights GATA2 nonsense, frameshift, splice site, and missense codon changes in codons 349 - 398 as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "3", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "FLT3", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 919, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 920, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights NPM1 p.W288Cfs*12 as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "3", "end_position": "170837544", "exon": "11", "feature_type": "somatic_variant", "gene": "NPM1", "protein_change": "p.W288Cfs*12", "reference_allele": null, "rsid": null, "start_position": "170837543", "variant_annotation": "Frameshift" } ], "feature_id": 920, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-03", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 921, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SRSF2 missense and in-frame deletion variants involving P95 codon as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.284C>A", "chromosome": "17", "end_position": "74732959", "exon": "1", "feature_type": "somatic_variant", "gene": "SRSF2", "protein_change": "p.P95H", "reference_allele": "G", "rsid": "rs751713049", "start_position": "74732959", "variant_annotation": "Missense" } ], "feature_id": 921, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-06", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 922, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SRSF2 missense and in-frame deletion variants involving P95 codon as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.284C>T", "chromosome": "17", "end_position": "74732959", "exon": "1", "feature_type": "somatic_variant", "gene": "SRSF2", "protein_change": "p.P95L", "reference_allele": "G", "rsid": "rs751713049", "start_position": "74732959", "variant_annotation": "Missense" } ], "feature_id": 922, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-06", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 923, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SRSF2 missense and in-frame deletion variants involving P95 codon as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.284C>G", "chromosome": "17", "end_position": "74732959", "exon": "1", "feature_type": "somatic_variant", "gene": "SRSF2", "protein_change": "p.P95R", "reference_allele": "G", "rsid": "rs751713049", "start_position": "74732959", "variant_annotation": "Missense" } ], "feature_id": 923, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-06", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 924, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SRSF2 missense and in-frame deletion variants involving P95 codon as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.283C>G", "chromosome": "17", "end_position": "74732960", "exon": "1", "feature_type": "somatic_variant", "gene": "SRSF2", "protein_change": "p.P95A", "reference_allele": "G", "rsid": "rs752405402", "start_position": "74732960", "variant_annotation": "Missense" } ], "feature_id": 924, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-06", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 925, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights SRSF2 missense and in-frame deletion variants involving P95 codon as being associated with poor prognosis in patients with myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "-", "cdna_change": "c.284_307del", "chromosome": "17", "end_position": "74732959", "exon": "1", "feature_type": "somatic_variant", "gene": "SRSF2", "protein_change": "p.P95_R102del", "reference_allele": "GGCGGCTGTGGTGTGAGTCCGGGG", "rsid": null, "start_position": "74732936", "variant_annotation": "Deletion" } ], "feature_id": 925, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-06", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 926, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights WT1 frameshift, splice site, and nonsense variants as associated with poor prognosis in myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "WT1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 926, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 927, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights WT1 frameshift, splice site, and nonsense variants as associated with poor prognosis in myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "WT1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 927, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 928, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights WT1 frameshift, splice site, and nonsense variants as associated with poor prognosis in myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "WT1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 928, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 929, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights U2AF1 missense variants involving either S34 or Q157 codons as associated with poor prognosis in myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.100T>G", "chromosome": "21", "end_position": "44524457", "exon": "2", "feature_type": "somatic_variant", "gene": "U2AF1", "protein_change": "p.S34A", "reference_allele": "A", "rsid": null, "start_position": "44524457", "variant_annotation": "Missense" } ], "feature_id": 929, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 930, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights U2AF1 missense variants involving either S34 or Q157 codons as associated with poor prognosis in myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.101C>T", "chromosome": "21", "end_position": "44524456", "exon": "2", "feature_type": "somatic_variant", "gene": "U2AF1", "protein_change": "p.S34F", "reference_allele": "G", "rsid": "rs371769427", "start_position": "44524456", "variant_annotation": "Missense" } ], "feature_id": 930, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 931, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights U2AF1 missense variants involving either S34 or Q157 codons as associated with poor prognosis in myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "GA", "cdna_change": "c.101_102delinsTC", "chromosome": "21", "end_position": "44524456", "exon": "2", "feature_type": "somatic_variant", "gene": "U2AF1", "protein_change": "p.S34F", "reference_allele": "AG", "rsid": null, "start_position": "44524455", "variant_annotation": "Missense" } ], "feature_id": 931, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 932, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights U2AF1 missense variants involving either S34 or Q157 codons as associated with poor prognosis in myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.101C>A", "chromosome": "21", "end_position": "44524456", "exon": "2", "feature_type": "somatic_variant", "gene": "U2AF1", "protein_change": "p.S34Y", "reference_allele": "G", "rsid": "rs371769427", "start_position": "44524456", "variant_annotation": "Missense" } ], "feature_id": 932, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 933, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights U2AF1 missense variants involving either S34 or Q157 codons as associated with poor prognosis in myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "AG", "cdna_change": "c.470_471inv", "chromosome": "21", "end_position": "44514777", "exon": "6", "feature_type": "somatic_variant", "gene": "U2AF1", "protein_change": "p.Q157P", "reference_allele": "CT", "rsid": null, "start_position": "44514776", "variant_annotation": "Missense" } ], "feature_id": 933, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 934, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights U2AF1 missense variants involving either S34 or Q157 codons as associated with poor prognosis in myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.470A>C", "chromosome": "21", "end_position": "44514777", "exon": "6", "feature_type": "somatic_variant", "gene": "U2AF1", "protein_change": "p.Q157P", "reference_allele": "T", "rsid": "rs371246226", "start_position": "44514777", "variant_annotation": "Missense" } ], "feature_id": 934, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 935, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The National Comprehensive Cancer Network\u00ae (NCCN\u00ae) highlights U2AF1 missense variants involving either S34 or Q157 codons as associated with poor prognosis in myelodysplastic syndromes.", "disease": "Myelodysplasia", "favorable_prognosis": 0, "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.470A>G", "chromosome": "21", "end_position": "44514777", "exon": "6", "feature_type": "somatic_variant", "gene": "U2AF1", "protein_change": "p.Q157R", "reference_allele": "T", "rsid": "rs371246226", "start_position": "44514777", "variant_annotation": "Missense" } ], "feature_id": 935, "feature_type": "somatic_variant" } ], "last_updated": "2023-11-02", "oncotree_code": "MDS", "oncotree_term": "Myelodysplasia", "predictive_implication": "Guideline", "sources": [ { "citation": "Referenced with permission from the NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines\u00ae) for Myelodysplastic Syndromes V.2.2023. \u00a9 National Comprehensive Cancer Network, Inc. 2023. All rights reserved. Accessed November 2, 2023. To view the most recent and complete version of the guideline, go online to NCCN.org.", "doi": "", "nct": "", "pmid": "", "source_id": 33, "source_type": "Guideline", "url": "https://www.nccn.org/professionals/physician_gls/pdf/mds_blocks.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "", "therapy_resistance": "", "therapy_sensitivity": "", "therapy_strategy": "", "therapy_type": "", "validated": true }, { "assertion_id": 937, "context": "Locally advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to capivasertib in combination with fulvestrant for the treatment of adult patients with locally advanced or metastatic hormone receptor (HR)-positive, human epidermal growth factor receptor 2 (HER2)-negative breast cancer with one or more PIK3CA/AKT1/PTEN-alterations, as detected by an FDA-approved test, following progression on at least one endocrine-based regimen in the metastatic setting or recurrence on or within 12 months of completing adjuvant therapy. The efficacy of capivasertib in combination with fulvestrant was evaluated in CAPItello-291 (NCT04305496), which described biomarker eligibility as PIK3CA/AKT1 activating mutations or PTEN loss of function alterations.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "3", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 937, "feature_type": "somatic_variant" } ], "last_updated": "2023-12-07", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Truqap (capivasertib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/218197s000lbl.pdf. Revised November 2023. Accessed December 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 273, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/218197s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Capivasertib + Fulvestrant", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition + ER signaling inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 938, "context": "Locally advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to capivasertib in combination with fulvestrant for the treatment of adult patients with locally advanced or metastatic hormone receptor (HR)-positive, human epidermal growth factor receptor 2 (HER2)-negative breast cancer with one or more PIK3CA/AKT1/PTEN-alterations, as detected by an FDA-approved test, following progression on at least one endocrine-based regimen in the metastatic setting or recurrence on or within 12 months of completing adjuvant therapy. The efficacy of capivasertib in combination with fulvestrant was evaluated in CAPItello-291 (NCT04305496), which described biomarker eligibility as PIK3CA/AKT1 activating mutations or PTEN loss of function alterations.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "14", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "AKT1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 938, "feature_type": "somatic_variant" } ], "last_updated": "2023-12-07", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Truqap (capivasertib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/218197s000lbl.pdf. Revised November 2023. Accessed December 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 273, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/218197s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Capivasertib + Fulvestrant", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition + ER signaling inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 939, "context": "Locally advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to capivasertib in combination with fulvestrant for the treatment of adult patients with locally advanced or metastatic hormone receptor (HR)-positive, human epidermal growth factor receptor 2 (HER2)-negative breast cancer with one or more PIK3CA/AKT1/PTEN-alterations, as detected by an FDA-approved test, following progression on at least one endocrine-based regimen in the metastatic setting or recurrence on or within 12 months of completing adjuvant therapy. The efficacy of capivasertib in combination with fulvestrant was evaluated in CAPItello-291 (NCT04305496), which described biomarker eligibility as PIK3CA/AKT1 activating mutations or PTEN loss of function alterations.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "10", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PTEN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Nonsense" } ], "feature_id": 939, "feature_type": "somatic_variant" } ], "last_updated": "2023-12-07", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Truqap (capivasertib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/218197s000lbl.pdf. Revised November 2023. Accessed December 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 273, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/218197s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Capivasertib + Fulvestrant", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition + ER signaling inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 940, "context": "Locally advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to capivasertib in combination with fulvestrant for the treatment of adult patients with locally advanced or metastatic hormone receptor (HR)-positive, human epidermal growth factor receptor 2 (HER2)-negative breast cancer with one or more PIK3CA/AKT1/PTEN-alterations, as detected by an FDA-approved test, following progression on at least one endocrine-based regimen in the metastatic setting or recurrence on or within 12 months of completing adjuvant therapy. The efficacy of capivasertib in combination with fulvestrant was evaluated in CAPItello-291 (NCT04305496), which described biomarker eligibility as PIK3CA/AKT1 activating mutations or PTEN loss of function alterations.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "10", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PTEN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Frameshift" } ], "feature_id": 940, "feature_type": "somatic_variant" } ], "last_updated": "2023-12-07", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Truqap (capivasertib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/218197s000lbl.pdf. Revised November 2023. Accessed December 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 273, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/218197s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Capivasertib + Fulvestrant", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition + ER signaling inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 941, "context": "Locally advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to capivasertib in combination with fulvestrant for the treatment of adult patients with locally advanced or metastatic hormone receptor (HR)-positive, human epidermal growth factor receptor 2 (HER2)-negative breast cancer with one or more PIK3CA/AKT1/PTEN-alterations, as detected by an FDA-approved test, following progression on at least one endocrine-based regimen in the metastatic setting or recurrence on or within 12 months of completing adjuvant therapy. The efficacy of capivasertib in combination with fulvestrant was evaluated in CAPItello-291 (NCT04305496), which described biomarker eligibility as PIK3CA/AKT1 activating mutations or PTEN loss of function alterations.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "10", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PTEN", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 941, "feature_type": "somatic_variant" } ], "last_updated": "2023-12-07", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Truqap (capivasertib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/218197s000lbl.pdf. Revised November 2023. Accessed December 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 273, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/218197s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Capivasertib + Fulvestrant", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition + ER signaling inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 942, "context": "Locally advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to capivasertib in combination with fulvestrant for the treatment of adult patients with locally advanced or metastatic hormone receptor (HR)-positive, human epidermal growth factor receptor 2 (HER2)-negative breast cancer with one or more PIK3CA/AKT1/PTEN-alterations, as detected by an FDA-approved test, following progression on at least one endocrine-based regimen in the metastatic setting or recurrence on or within 12 months of completing adjuvant therapy. The efficacy of capivasertib in combination with fulvestrant was evaluated in CAPItello-291 (NCT04305496), which described biomarker eligibility as PIK3CA/AKT1 activating mutations or PTEN loss of function alterations.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Deletion", "feature_type": "copy_number", "gene": "PTEN" } ], "feature_id": 942, "feature_type": "copy_number" } ], "last_updated": "2023-12-07", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Truqap (capivasertib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/218197s000lbl.pdf. Revised November 2023. Accessed December 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 273, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/218197s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Capivasertib + Fulvestrant", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition + ER signaling inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 943, "context": "Advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) approved neratinib in combination with capecitabine for the treatment of adult patients with advanced or metastatic HER2-positive breast cancer who have received two or more prior anti-HER2 based regimens in the metastatic setting.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "cytoband": null, "direction": "Amplification", "feature_type": "copy_number", "gene": "ERBB2" } ], "feature_id": 943, "feature_type": "copy_number" } ], "last_updated": "2025-01-08", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Puma Biotechnology, Inc. Nerlynx (neratinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/208051s009lbl.pdf. Revised June 2021. Accessed January 11, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 202, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/208051s009lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Capecitabine + Neratinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ER signaling inhibition + Thymidylate synthase inhibitor", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 944, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) approved vemurafenib for the treatment of patients with Erdheim-Chester disease and whose tumors harbor a BRAF V600 mutation.", "disease": "Non-Langerhans Cell Histiocytosis/Erdheim-Chester Disease", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 944, "feature_type": "somatic_variant" } ], "last_updated": "2024-01-30", "oncotree_code": "ECD", "oncotree_term": "Non-Langerhans Cell Histiocytosis/Erdheim-Chester Disease", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Zelboraf (vemurafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202429s019lbl.pdf. Revised May 2020. Accessed January 30, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 274, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202429s019lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 945, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) approved vemurafenib for the treatment of patients with Erdheim-Chester disease and whose tumors harbor a BRAF V600 mutation.", "disease": "Non-Langerhans Cell Histiocytosis/Erdheim-Chester Disease", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "TT", "cdna_change": "c.1798_1799GT>AA", "chromosome": "7", "end_position": "140453137", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600K", "reference_allele": "AC", "rsid": "rs121913227", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 945, "feature_type": "somatic_variant" } ], "last_updated": "2024-01-30", "oncotree_code": "ECD", "oncotree_term": "Non-Langerhans Cell Histiocytosis/Erdheim-Chester Disease", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Zelboraf (vemurafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202429s019lbl.pdf. Revised May 2020. Accessed January 30, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 274, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/202429s019lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vemurafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "B-RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 946, "context": "Locally advanced or metastatic disease which has progressed on or after platinum-based chemotherapy.", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to amivantamab-vmjw in combination with carboplatin and pemetrexed for the first-line treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with epidermal growth factor receptor (EGFR) exon 20 insertion mutations, as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Insertion" } ], "feature_id": 946, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Janssen Biotech, Inc. Rybrevant (amivantamab-vmjw) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/761210s003lbl.pdf. Revised March 2024. Accessed March 4, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 275, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/761210s003lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Amivantamab + Carboplatin + Pemetrexed", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition + Platinum-based chemotherapy + Antifolate", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 947, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to osimertinib in combination with platinum-based chemotherapy and pemetrexed for the first-line treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with epidermal growth factor receptor (EGFR) exon 19 deletions or exon 21 p.L858R variants, as detected by an FDA-approved test. The efficacy of this indication was demonstrated in a randomized, multicenter, open-label trial (FLAURA2 [NCT04035486]), where patients enrolled in the study arm received osimertinib in combination with pemetrexed and investigator's choice of either cisplatin or carboplatin while patients of the control arm received osimertinib monotherapy.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "19", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Deletion" } ], "feature_id": 947, "feature_type": "somatic_variant" } ], "last_updated": "2024-03-04", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Tagrisso (osimertinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/208065s030lbl.pdf. Revised February 2024. Accessed March 4, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 276, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/208065s030lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cisplatin + Osimertinib + Pemetrexed", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy + EGFR inhibition + Antifolate", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 948, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to osimertinib in combination with platinum-based chemotherapy and pemetrexed for the first-line treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with epidermal growth factor receptor (EGFR) exon 19 deletions or exon 21 p.L858R variants, as detected by an FDA-approved test. The efficacy of this indication was demonstrated in a randomized, multicenter, open-label trial (FLAURA2 [NCT04035486]), where patients enrolled in the study arm received osimertinib in combination with pemetrexed and investigator's choice of either cisplatin or carboplatin while patients of the control arm received osimertinib monotherapy.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2573T>G", "chromosome": "7", "end_position": "55259515", "exon": "21", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.L858R", "reference_allele": "T", "rsid": "rs121434568", "start_position": "55259515", "variant_annotation": "Missense" } ], "feature_id": 948, "feature_type": "somatic_variant" } ], "last_updated": "2024-03-04", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Tagrisso (osimertinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/208065s030lbl.pdf. Revised February 2024. Accessed March 4, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 276, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/208065s030lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cisplatin + Osimertinib + Pemetrexed", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Platinum-based chemotherapy + EGFR inhibition + Antifolate", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 949, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for osimertinib for the first-line treatment of adult patients with metastatic non-small cell lung cancer whose tumors have epidermal growth factor receptor (EGFR) exon 19 deletions or an exon 21 p.L858R variant, as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "19", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Deletion" } ], "feature_id": 949, "feature_type": "somatic_variant" } ], "last_updated": "2024-03-04", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Tagrisso (osimertinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/208065s008lbl.pdf. Revised April 2018. Accessed March 4, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 277, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/208065s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Osimertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 950, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for osimertinib for the first-line treatment of adult patients with metastatic non-small cell lung cancer whose tumors have epidermal growth factor receptor (EGFR) exon 19 deletions or an exon 21 p.L858R variant, as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2573T>G", "chromosome": "7", "end_position": "55259515", "exon": "21", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.L858R", "reference_allele": "T", "rsid": "rs121434568", "start_position": "55259515", "variant_annotation": "Missense" } ], "feature_id": 950, "feature_type": "somatic_variant" } ], "last_updated": "2024-03-04", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Tagrisso (osimertinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/208065s008lbl.pdf. Revised April 2018. Accessed March 4, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 277, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/208065s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Osimertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 951, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted traditional approval to tepotinib for the treatment of adult patients with metastatic non-small cell lung cancer whose tumors harbor MET exon 14 skipping alterations.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "14", "feature_type": "somatic_variant", "gene": "MET", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Splice Site" } ], "feature_id": 951, "feature_type": "somatic_variant" } ], "last_updated": "2024-03-04", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "EMD Serono, Inc. Tepmetko (tepotinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/214096s003lbl.pdf. Revised February 2024. Accessed March 4, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 278, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/214096s003lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tepotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 952, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted traditional approval to tepotinib for the treatment of adult patients with metastatic non-small cell lung cancer whose tumors harbor MET exon 14 skipping alterations.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "14", "feature_type": "somatic_variant", "gene": "MET", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Deletion" } ], "feature_id": 952, "feature_type": "somatic_variant" } ], "last_updated": "2024-03-04", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "EMD Serono, Inc. Tepmetko (tepotinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/214096s003lbl.pdf. Revised February 2024. Accessed March 4, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 278, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/214096s003lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tepotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 953, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to crizotinib for the treatment of pediatric patients 1 year of age or older and young adults with relapsed or refactory, systemic anaplastic large cell lymphoma (ALCL) that is ALK-positive. The safety and efficacy of crizotinib have not been established in older adults with relapsed or refactory systemic ALK-positive ALCL.", "disease": "Anaplastic Large Cell Lymphoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ALK", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 953, "feature_type": "rearrangement" } ], "last_updated": "2024-03-04", "oncotree_code": "ALCL", "oncotree_term": "Anaplastic Large Cell Lymphoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Xalkori (crizotinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/202570s030lbl.pdf. Revised January 2021. Accessed August 4th, 2022.", "doi": "", "nct": "", "pmid": "", "source_id": 279, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/202570s030lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Crizotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MET inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 954, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval for entrectinib for adult patients with metastatic non-small cell lung cancer (NSCLC) whose tumors are ROS1-positive.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ROS1", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 954, "feature_type": "rearrangement" } ], "last_updated": "2024-04-11", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Rozlytrek (entrectinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/212726s000lbl.pdf. Revised August 2019. Accessed November 12, 2020.", "doi": "", "nct": "", "pmid": "", "source_id": 40, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/212726s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Entrectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ROS1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 955, "context": "Locally advanced or metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to repotrectinib for the treatment of patients with locally advanced or metastatic ROS1-positive non-small cell lung cancer (NSCLC).", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ROS1", "gene2": null, "locus": null, "rearrangement_type": null } ], "feature_id": 955, "feature_type": "rearrangement" } ], "last_updated": "2024-04-11", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Bristol-Myers Squibb Company. Augtyro (repotrectinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/218213s000lbl.pdf. Revised November 2023. Accessed December 5, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 272, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/218213s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Repotrectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ROS1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 956, "context": "Metastatic castration-resistant", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to talazoparib in combination with enzalutamide for the treatment of adult patients with HRR gene-mutated metastatic castration-resistant prostate cancer (mCRPC).", "disease": "Prostate Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "MRE11", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 956, "feature_type": "somatic_variant" } ], "last_updated": "2024-04-11", "oncotree_code": "PRAD", "oncotree_term": "Prostate Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Pfizer, Inc. Talzenna (talazoparib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf. Revised June 2023. Accessed July 6, 2023.", "doi": "", "nct": "", "pmid": "", "source_id": 261, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2023/211651s010lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Enzalutamide + Talazoparib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Antiandrogen + PARP inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 957, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to ponatinib in combination with chemotherapy for the treatment of adult patients with newly diagnosed Philadelphia chromosome-positive acute lymphoblastic leukemia. Ponatinib's package insert further states that this indication is approved under accelerated approval based on minimal residual disease (MRD)-negative complete transmission (CR) at the end of induction.", "disease": "Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BCR", "gene2": "ABL1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 957, "feature_type": "rearrangement" } ], "last_updated": "2025-02-13", "oncotree_code": "ALL", "oncotree_term": "Acute Lymphoid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Takeda Pharmaceuticals America, Inc. Iclusig (ponatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/203469s037lbl.pdf. Revised March 2024. Accessed April 11, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 280, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/203469s037lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Chemotherapy + Ponatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "targets BCR-ABL + Chemotherapy", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 958, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to ponatinib for the treatment of adult patients with Philadelphia chromosome-positive (Ph+) acute lymphoblastic leukemia (ALL) for whom no other kinase inhibitors are indicated.", "disease": "Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BCR", "gene2": "ABL1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 958, "feature_type": "rearrangement" } ], "last_updated": "2024-04-11", "oncotree_code": "ALL", "oncotree_term": "Acute Lymphoid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Takeda Pharmaceuticals America, Inc. Iclusig (ponatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2013/203469s007s008lbl.pdf. Revised December 2013. Accessed April 11, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 281, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2013/203469s007s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ponatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "targets BCR-ABL", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 959, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to ponatinib for the treatment of adult patients with T315I-positive Philadelphia chromosome-positive (Ph+) acute lymphoblastic leukemia (ALL).", "disease": "Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BCR", "gene2": "ABL1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 959, "feature_type": "rearrangement" } ], "last_updated": "2024-04-11", "oncotree_code": "ALL", "oncotree_term": "Acute Lymphoid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Takeda Pharmaceuticals America, Inc. Iclusig (ponatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2013/203469s007s008lbl.pdf. Revised December 2013. Accessed April 11, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 281, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2013/203469s007s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ponatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "targets BCR-ABL", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 960, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to ponatinib for the treatment of adult patients with T315I-positive Philadelphia chromosome-positive (Ph+) acute lymphoblastic leukemia (ALL).", "disease": "Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.944C>T", "chromosome": "9", "end_position": "133748283", "exon": "5", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.T315I", "reference_allele": "C", "rsid": "rs121913459", "start_position": "133748283", "variant_annotation": "Missense" } ], "feature_id": 960, "feature_type": "somatic_variant" } ], "last_updated": "2024-04-11", "oncotree_code": "ALL", "oncotree_term": "Acute Lymphoid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Takeda Pharmaceuticals America, Inc. Iclusig (ponatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2013/203469s007s008lbl.pdf. Revised December 2013. Accessed April 11, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 281, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2013/203469s007s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ponatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "targets BCR-ABL", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 961, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to ponatinib for the treatment of adult patients with T315I-positive chronic myeloid leukemia (CML) in the chronic phase, accelerated phase, or blast phase.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.944C>T", "chromosome": "9", "end_position": "133748283", "exon": "5", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.T315I", "reference_allele": "C", "rsid": "rs121913459", "start_position": "133748283", "variant_annotation": "Missense" } ], "feature_id": 961, "feature_type": "somatic_variant" } ], "last_updated": "2024-04-11", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Takeda Pharmaceuticals America, Inc. Iclusig (ponatinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2013/203469s007s008lbl.pdf. Revised December 2013. Accessed April 11, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 281, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2013/203469s007s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ponatinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "targets BCR-ABL", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 962, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to alectinib for the adjuvant treatment of adult patients following tumor resection of with anaplastic lymphoma kinase (ALK)-positive non-small cell lung cancer (NSCLC) (tumors >= 4 cm or node positive) as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ALK", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 962, "feature_type": "rearrangement" } ], "last_updated": "2025-04-01", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Alecensa (alectinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/208434s015lbl.pdf. Revised April 2024. Accessed June 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 282, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/208434s015lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Alectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ALK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 963, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to tovorafenib for the treatment of patients 6 months of age and older with relapsed or refractory pediatric low-grade glioma (LGG) harboring a BRAF fusion or rearrangement, or BRAF V600 mutation.", "disease": "Low-Grade Glioma, NOS", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "TT", "cdna_change": "c.1798_1799GT>AA", "chromosome": "7", "end_position": "140453137", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600K", "reference_allele": "AC", "rsid": "rs121913227", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 963, "feature_type": "somatic_variant" } ], "last_updated": "2024-06-03", "oncotree_code": "LGGNOS", "oncotree_term": "Low-Grade Glioma, NOS", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Day One Biopharmaceuticals, Inc. Ojemda (tovorafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/217700s000lbl.pdf. Revised April 2024. Accessed June 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 283, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/217700s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tovorafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 964, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to tovorafenib for the treatment of patients 6 months of age and older with relapsed or refractory pediatric low-grade glioma (LGG) harboring a BRAF fusion or rearrangement, or BRAF V600 mutation.", "disease": "Low-Grade Glioma, NOS", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BRAF", "gene2": null, "locus": null, "rearrangement_type": null } ], "feature_id": 964, "feature_type": "rearrangement" } ], "last_updated": "2024-06-03", "oncotree_code": "LGGNOS", "oncotree_term": "Low-Grade Glioma, NOS", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Day One Biopharmaceuticals, Inc. Ojemda (tovorafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/217700s000lbl.pdf. Revised April 2024. Accessed June 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 283, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/217700s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tovorafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 965, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to tovorafenib for the treatment of patients 6 months of age and older with relapsed or refractory pediatric low-grade glioma (LGG) harboring a BRAF fusion or rearrangement, or BRAF V600 mutation.", "disease": "Low-Grade Glioma, NOS", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BRAF", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 965, "feature_type": "rearrangement" } ], "last_updated": "2024-06-03", "oncotree_code": "LGGNOS", "oncotree_term": "Low-Grade Glioma, NOS", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Day One Biopharmaceuticals, Inc. Ojemda (tovorafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/217700s000lbl.pdf. Revised April 2024. Accessed June 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 283, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/217700s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Tovorafenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RAF inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 966, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to erlotinib for the treatment of patients with metastatic non-small cell lung cancer whose tumors have epidermal growth factor receptor (EGFR) exon 19 deletions or exon 21 (p.L858R) substitution mutations as detected by an FDA-approved test receiving first-line, maintenance, or second or greater line treatment after progression following at least one prior chemotherapy regimen.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "19", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Deletion" } ], "feature_id": 966, "feature_type": "somatic_variant" } ], "last_updated": "2024-06-03", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "OSI Pharmaceuticals, LLC. Tarceva (erlotinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2016/021743s025lbl.pdf. Revised October 2016. Accessed June 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 284, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2016/021743s025lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Erlotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 967, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to erlotinib for the treatment of patients with metastatic non-small cell lung cancer whose tumors have epidermal growth factor receptor (EGFR) exon 19 deletions or exon 21 (p.L858R) substitution mutations as detected by an FDA-approved test receiving first-line, maintenance, or second or greater line treatment after progression following at least one prior chemotherapy regimen.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2573T>G", "chromosome": "7", "end_position": "55259515", "exon": "21", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.L858R", "reference_allele": "T", "rsid": "rs121434568", "start_position": "55259515", "variant_annotation": "Missense" } ], "feature_id": 967, "feature_type": "somatic_variant" } ], "last_updated": "2024-06-03", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "OSI Pharmaceuticals, LLC. Tarceva (erlotinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2016/021743s025lbl.pdf. Revised October 2016. Accessed June 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 284, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2016/021743s025lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Erlotinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 968, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to gefitinib for the first-line treatment of patients with metastatic non-small cell lung cancer whose tumors have epidermal growth factor receptor (EGFR) exon 19 deletions or exon 21 (L858R) substitution mutations as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "19", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Deletion" } ], "feature_id": 968, "feature_type": "somatic_variant" } ], "last_updated": "2024-06-03", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Astrazeneca Pharmaceuticals LP. Iressa (gefitinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/206995s004lbl.pdf. Revised May 2021. Accessed June 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 285, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/206995s004lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Gefitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 969, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to gefitinib for the first-line treatment of patients with metastatic non-small cell lung cancer whose tumors have epidermal growth factor receptor (EGFR) exon 19 deletions or exon 21 (L858R) substitution mutations as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2573T>G", "chromosome": "7", "end_position": "55259515", "exon": "21", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.L858R", "reference_allele": "T", "rsid": "rs121434568", "start_position": "55259515", "variant_annotation": "Missense" } ], "feature_id": 969, "feature_type": "somatic_variant" } ], "last_updated": "2024-06-03", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Astrazeneca Pharmaceuticals LP. Iressa (gefitinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/206995s004lbl.pdf. Revised May 2021. Accessed June 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 285, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/206995s004lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Gefitinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 970, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to repotrectinib for the treatment of adult and pediatric patients of age 12 years and older with solid tumors that (i) have a neurotrophic tyrosine receptor kinase (NTRK) gene fusion, and (ii) are locally advanced or metastatic or where surgical resection is likely to result in severe morbidity, (iii) have progressed following treatment or have no satisfactory alternative therapy. The FDA notes that this indication is approved under accelerated approval based on overall response rate and duration of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in the confirmatory trials.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "NTRK1", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 970, "feature_type": "rearrangement" } ], "last_updated": "2024-07-11", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Bristol-Myers Squibb Company. Augtyro (repotrectinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218213s001lbl.pdf. Revised June 2024. Accessed July 11, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 286, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218213s001lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Repotrectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "TRK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 971, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to repotrectinib for the treatment of adult and pediatric patients of age 12 years and older with solid tumors that (i) have a neurotrophic tyrosine receptor kinase (NTRK) gene fusion, and (ii) are locally advanced or metastatic or where surgical resection is likely to result in severe morbidity, (iii) have progressed following treatment or have no satisfactory alternative therapy. The FDA notes that this indication is approved under accelerated approval based on overall response rate and duration of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in the confirmatory trials.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "NTRK2", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 971, "feature_type": "rearrangement" } ], "last_updated": "2024-07-11", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Bristol-Myers Squibb Company. Augtyro (repotrectinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218213s001lbl.pdf. Revised June 2024. Accessed July 11, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 286, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218213s001lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Repotrectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "TRK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 972, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to repotrectinib for the treatment of adult and pediatric patients of age 12 years and older with solid tumors that (i) have a neurotrophic tyrosine receptor kinase (NTRK) gene fusion, and (ii) are locally advanced or metastatic or where surgical resection is likely to result in severe morbidity, (iii) have progressed following treatment or have no satisfactory alternative therapy. The FDA notes that this indication is approved under accelerated approval based on overall response rate and duration of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in the confirmatory trials.", "disease": "Any solid tumor", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "NTRK3", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 972, "feature_type": "rearrangement" } ], "last_updated": "2024-07-11", "oncotree_code": "", "oncotree_term": "Any solid tumor", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Bristol-Myers Squibb Company. Augtyro (repotrectinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218213s001lbl.pdf. Revised June 2024. Accessed July 11, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 286, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218213s001lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Repotrectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "TRK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 973, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to adagrasib in combination with cetuximab for the treatment of adult patients with KRAS G12C-mutated locally advanced or metastatic colorectal cancer (CRC), as determined by an FDA-approved test, who have received prior treatment with fluoropyrimidine-, oxaliplatin-, and irinotecan-based chemotherapy. The FDA notes that this indication is approved under accelerated approval based on objective response rate (ORR) and duration of response (DOR). Continued approval of this indication may be contingent upon verification and description of clinical benefit in confirmatory trials.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.34G>T", "chromosome": "12", "end_position": "25398285", "exon": "2", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": "p.G12C", "reference_allele": "C", "rsid": "rs121913530", "start_position": "25398285", "variant_annotation": "Missense" } ], "feature_id": 973, "feature_type": "somatic_variant" } ], "last_updated": "2024-07-11", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Mirati Therapeutics, Inc. Krazati (adagrasib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/216340s005lbl.pdf. Revised June 2024. Accessed July 11, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 287, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/216340s005lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Adagrasib + Cetuximab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "RAS inhibition + EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 974, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Astrocytoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "2", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 974, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ASTR", "oncotree_term": "Astrocytoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 975, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Astrocytoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.394C>T", "chromosome": "2", "end_position": "209113113", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132C", "reference_allele": "G", "rsid": "rs121913499", "start_position": "209113113", "variant_annotation": "Missense" } ], "feature_id": 975, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ASTR", "oncotree_term": "Astrocytoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 976, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Astrocytoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.394C>G", "chromosome": "2", "end_position": "209113113", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132G", "reference_allele": "G", "rsid": "rs121913499", "start_position": "209113113", "variant_annotation": "Missense" } ], "feature_id": 976, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ASTR", "oncotree_term": "Astrocytoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 977, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Astrocytoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.395G>A", "chromosome": "2", "end_position": "209113112", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132H", "reference_allele": "C", "rsid": "rs121913500", "start_position": "209113112", "variant_annotation": "Missense" } ], "feature_id": 977, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ASTR", "oncotree_term": "Astrocytoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 978, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Astrocytoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.395G>T", "chromosome": "2", "end_position": "209113112", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132L", "reference_allele": "C", "rsid": "rs121913500", "start_position": "209113112", "variant_annotation": "Missense" } ], "feature_id": 978, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ASTR", "oncotree_term": "Astrocytoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 979, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Astrocytoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.394C>A", "chromosome": "2", "end_position": "209113113", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132S", "reference_allele": "G", "rsid": "rs121913499", "start_position": "209113113", "variant_annotation": "Missense" } ], "feature_id": 979, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ASTR", "oncotree_term": "Astrocytoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 980, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Astrocytoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "15", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "IDH2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 980, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ASTR", "oncotree_term": "Astrocytoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 981, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Astrocytoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.515G>A", "chromosome": "15", "end_position": "90631837", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH2", "protein_change": "p.R172K", "reference_allele": "C", "rsid": "rs121913503", "start_position": "90631837", "variant_annotation": "Missense" } ], "feature_id": 981, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ASTR", "oncotree_term": "Astrocytoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 982, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Astrocytoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.514A>G", "chromosome": "15", "end_position": "90631839", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH2", "protein_change": "p.R172G", "reference_allele": "T", "rsid": "rs1057519906", "start_position": "90631839", "variant_annotation": "Missense" } ], "feature_id": 982, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ASTR", "oncotree_term": "Astrocytoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 983, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Oligodendroglioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "2", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 983, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ODG", "oncotree_term": "Oligodendroglioma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 984, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Oligodendroglioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.394C>T", "chromosome": "2", "end_position": "209113113", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132C", "reference_allele": "G", "rsid": "rs121913499", "start_position": "209113113", "variant_annotation": "Missense" } ], "feature_id": 984, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ODG", "oncotree_term": "Oligodendroglioma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 985, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Oligodendroglioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "C", "cdna_change": "c.394C>G", "chromosome": "2", "end_position": "209113113", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132G", "reference_allele": "G", "rsid": "rs121913499", "start_position": "209113113", "variant_annotation": "Missense" } ], "feature_id": 985, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ODG", "oncotree_term": "Oligodendroglioma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 986, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Oligodendroglioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.395G>A", "chromosome": "2", "end_position": "209113112", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132H", "reference_allele": "C", "rsid": "rs121913500", "start_position": "209113112", "variant_annotation": "Missense" } ], "feature_id": 986, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ODG", "oncotree_term": "Oligodendroglioma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 987, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Oligodendroglioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.395G>T", "chromosome": "2", "end_position": "209113112", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132L", "reference_allele": "C", "rsid": "rs121913500", "start_position": "209113112", "variant_annotation": "Missense" } ], "feature_id": 987, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ODG", "oncotree_term": "Oligodendroglioma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 988, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Oligodendroglioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.394C>A", "chromosome": "2", "end_position": "209113113", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH1", "protein_change": "p.R132S", "reference_allele": "G", "rsid": "rs121913499", "start_position": "209113113", "variant_annotation": "Missense" } ], "feature_id": 988, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ODG", "oncotree_term": "Oligodendroglioma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 989, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Oligodendroglioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "15", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "IDH2", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 989, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ODG", "oncotree_term": "Oligodendroglioma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 990, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to vorasidenib for the treatment of adult and pediatric patients 12 years and older with Grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation following surgery including biopsy, sub-total resection, or gross total resection. This approval is based on INDIGO (NCT04164901), a randomized, multicenter, double-blind, placebo-controlled trial. IDH mutation status was determined using Oncomine Dx Target Test to confirm detection of IDH1 mutation variants (p.R132H, p.R132C, p.R132G, p.R132S, or p.R132L) and IDH2 mutation variants (p.R172K, p.R172M, p.R172W, p.R172S, or p.R172G). Within the vorasidenib arm of the trial, they observed 163 patients that were IDH1-positive and 5 that were IDH2-positive with the amino acid changes of: IDH1 p.R132C (8), p.R132G (5), p.R132H (146), p.R132L (2), p.R132S (2), and IDH2 p.R172K (5) and p.R172G (2).", "disease": "Oligodendroglioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.515G>A", "chromosome": "15", "end_position": "90631837", "exon": "4", "feature_type": "somatic_variant", "gene": "IDH2", "protein_change": "p.R172K", "reference_allele": "C", "rsid": "rs121913503", "start_position": "90631837", "variant_annotation": "Missense" } ], "feature_id": 990, "feature_type": "somatic_variant" } ], "last_updated": "2024-09-03", "oncotree_code": "ODG", "oncotree_term": "Oligodendroglioma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Servier Pharmaceuticals LLC. Voranigo (vorasidenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 288, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218784s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Vorasidenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "IDH inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 991, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to lazertinib in combination with amivantamab for the first-line treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with epidermal growth factor receptor (EGFR) exon 19 deletions or exon 21 L858R substitution mutations, as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2573T>G", "chromosome": "7", "end_position": "55259515", "exon": "21", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.L858R", "reference_allele": "T", "rsid": "rs121434568", "start_position": "55259515", "variant_annotation": "Missense" } ], "feature_id": 991, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Janssen Biotech, Inc. Lazcluze (lazertinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/219008s000lbledt.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 289, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/219008s000lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Amivantamab + Lazertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 992, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to lazertinib in combination with amivantamab for the first-line treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with epidermal growth factor receptor (EGFR) exon 19 deletions or exon 21 L858R substitution mutations, as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "19", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Deletion" } ], "feature_id": 992, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Janssen Biotech, Inc. Lazcluze (lazertinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/219008s000lbledt.pdf. Revised August 2024. Accessed September 3, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 289, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/219008s000lbledt.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Amivantamab + Lazertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 993, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to amivantamab-vmjw in combination with carboplatin and pemetrexed for the treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with EGFR exon 19 deletions or exon 21 p.L858R substitution mutations, whose disease has progressed on or after treatment with an EGFR tyrosine kinase inhibitor.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "G", "cdna_change": "c.2573T>G", "chromosome": "7", "end_position": "55259515", "exon": "21", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.L858R", "reference_allele": "T", "rsid": "rs121434568", "start_position": "55259515", "variant_annotation": "Missense" } ], "feature_id": 993, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Janssen Biotech, Inc. Rybrevant (amivantamab-vmjw) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/761210s004lbl.pdf. Revised September 2024. Accessed October 2, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 290, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/761210s004lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Amivantamab + Carboplatin + Pemetrexed", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition + Platinum-based chemotherapy + Antifolate", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 994, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to amivantamab-vmjw in combination with carboplatin and pemetrexed for the treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with EGFR exon 19 deletions or exon 21 p.L858R substitution mutations, whose disease has progressed on or after treatment with an EGFR tyrosine kinase inhibitor.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "19", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Deletion" } ], "feature_id": 994, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Janssen Biotech, Inc. Rybrevant (amivantamab-vmjw) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/761210s004lbl.pdf. Revised September 2024. Accessed October 2, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 290, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/761210s004lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Amivantamab + Carboplatin + Pemetrexed", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition + Platinum-based chemotherapy + Antifolate", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 995, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to osimertinib for the treatment of adult patients with locally advanced, unresectable (stage III) non-small cell lung cancer (NSCLC) whose disease has not progressed during or following concurrent or sequential platinum-based chemoradiation therapy and whose tumors have EGFR exon 19 deletions or exon 21 p.L858R mutations, as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "19", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Deletion" } ], "feature_id": 995, "feature_type": "somatic_variant" } ], "last_updated": "2024-10-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Tagrisso (osimertinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/208065s033lbl.pdf. Revised September 2024. Accessed October 2, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 291, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/208065s033lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Osimertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 996, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to osimertinib for the treatment of adult patients with locally advanced, unresectable (stage III) non-small cell lung cancer (NSCLC) whose disease has not progressed during or following concurrent or sequential platinum-based chemoradiation therapy and whose tumors have EGFR exon 19 deletions or exon 21 p.L858R mutations, as detected by an FDA-approved test.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.2369C>T", "chromosome": "7", "end_position": "55249071", "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": "p.T790M", "reference_allele": "C", "rsid": "rs121434569", "start_position": "55249071", "variant_annotation": "Missense" } ], "feature_id": 996, "feature_type": "somatic_variant" } ], "last_updated": "2024-10-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "AstraZeneca Pharmaceuticals, LP. Tagrisso (osimertinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/208065s033lbl.pdf. Revised September 2024. Accessed October 2, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 291, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/208065s033lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Osimertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 997, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to asciminib for the treatment of adult patients with newly diagnosed Philadelphia chromosome-positive chronic myeloid leukemia (Ph+ CML) in chronic phase (CP).", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BCR", "gene2": "ABL1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 997, "feature_type": "rearrangement" } ], "last_updated": "2024-11-06", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Scemblix (asciminib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/215358Orig1s008lbl.pdf. Revised October 2024. Accessed November 6, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 6, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/215358Orig1s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Asciminib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 998, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to asciminib for the treatment of adult patients with Philadelphia chromosome-positive chronic myeloid leukemia (Ph+ CML) and ABL1 p.T315I.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "BCR", "gene2": "ABL1", "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 998, "feature_type": "rearrangement" } ], "last_updated": "2024-11-06", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Scemblix (asciminib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/215358Orig1s008lbl.pdf. Revised October 2024. Accessed November 6, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 6, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/215358Orig1s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Asciminib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 999, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to asciminib for the treatment of adult patients with Philadelphia chromosome-positive chronic myeloid leukemia (Ph+ CML) and ABL1 p.T315I.", "disease": "Chronic Myelogenous Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.944C>T", "chromosome": "9", "end_position": "133748283", "exon": "5", "feature_type": "somatic_variant", "gene": "ABL1", "protein_change": "p.T315I", "reference_allele": "C", "rsid": "rs121913459", "start_position": "133748283", "variant_annotation": "Missense" } ], "feature_id": 999, "feature_type": "somatic_variant" } ], "last_updated": "2024-11-06", "oncotree_code": "CML", "oncotree_term": "Chronic Myelogenous Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Novartis Pharmaceuticals Corporation. Scemblix (asciminib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/215358Orig1s008lbl.pdf. Revised October 2024. Accessed November 6, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 6, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/215358Orig1s008lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Asciminib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "BCR-ABL inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1000, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to inavolisib in combination with fulvestrant and palbociclib for the treatment of adult patients with endocrine-resistant, PIK3CA-mutated, hormone receptor (HR)-positive, human epidermal growth factor receptor 2 (HER2)-negative, locally advanced or metastatic breast cancer, as detected by an FDA-approved test, following recurrence on or after completing adjuvant endocrine therapy. Inavolisib's drug label further states that patients should be selected based on the presence of one or more PIK3CA mutations in plasma specimen. This approval is based on INAVO120 (NCT04191499), a phase 3 double-blind, randomized trial, where PIK3CA mutation status was prospectively determined in a central laboratory using the FoundationOne Liquid CDx assay on plasma-derived circulating tumor DNA (ctDNA) or in local laboratories using various validated polymerase chain reaction (PCR) or next-generation sequencing (NGS) assays on tumor tissue or plasma.", "disease": "Invasive Breast Carcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": null, "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "PIK3CA", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 1000, "feature_type": "somatic_variant" } ], "last_updated": "2024-11-07", "oncotree_code": "BRCA", "oncotree_term": "Invasive Breast Carcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Genentech, Inc. Itovebi (inavolisib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/219249s000lbl.pdf. Revised October 2024. Accessed November 6, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 292, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/219249s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Fulvestrant + Inavolisib + Palbociclib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "PI3K/AKT/mTOR inhibition + ER signaling inhibition + CDK4/6 inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 1001, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to revumenib for the treatment of adult and pediatric patients 1 year and older with relapsed or refractory acute leukemia with a lysine methyltransferase 2A gene (KMT2A) translocation.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "KMT2A", "gene2": null, "locus": null, "rearrangement_type": "Translocation" } ], "feature_id": 1001, "feature_type": "rearrangement" } ], "last_updated": "2024-12-05", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Syndax Pharmaceuticals, Inc. Revuforj (revumenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218944s000lbl.pdf. Revised November 2024. Accessed December 5, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 293, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218944s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Revumenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Menin inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1002, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to revumenib for the treatment of adult and pediatric patients 1 year and older with relapsed or refractory acute leukemia with a lysine methyltransferase 2A gene (KMT2A) translocation.", "disease": "Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "KMT2A", "gene2": null, "locus": null, "rearrangement_type": "Translocation" } ], "feature_id": 1002, "feature_type": "rearrangement" } ], "last_updated": "2024-12-05", "oncotree_code": "ALL", "oncotree_term": "Acute Lymphoid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Syndax Pharmaceuticals, Inc. Revuforj (revumenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218944s000lbl.pdf. Revised November 2024. Accessed December 5, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 293, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218944s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Revumenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Menin inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1003, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to zenocutuzumab-zbco for the treatment of adult patients with advanced, unresectable or metastatic non-small cell lung cancer (NSCLC) harboring a neuregulin 1 (NRG1) gene fusion with disease progression on or after prior systemic therapy.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "NRG1", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 1003, "feature_type": "rearrangement" } ], "last_updated": "2025-02-13", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Merus N.V. Bizengri (zenocutuzumab-zbco) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/761352s001lbl.pdf. Revised December 2024. Accessed December 5, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 294, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/761352s001lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Zenocutuzumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "NRG1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1004, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to zenocutuzumab-zbco for the treatment of adult patients with advanced, unresectable or metastatic pancreatic adenocarcinoma harboring a neuregulin 1 (NRG1) gene fusion with disease progression on or after prior systemic therapy.", "disease": "Pancreatic Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "NRG1", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 1004, "feature_type": "rearrangement" } ], "last_updated": "2025-02-13", "oncotree_code": "PAAD", "oncotree_term": "Pancreatic Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Merus N.V. Bizengri (zenocutuzumab-zbco) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/761352s001lbl.pdf. Revised December 2024. Accessed December 5, 2024.", "doi": "", "nct": "", "pmid": "", "source_id": 294, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/761352s001lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Zenocutuzumab", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "NRG1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1005, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted regular approval for ensartinib for the treatment of adult patients with anaplastic lymphoma kinase (ALK)-positive locally advanced or metastatic non-small cell lung cancer (NSCLC) who have not previously received an ALK inhibitor. The product label instructs to select patients based on the presence of ALK rearrangement(s) in tumor specimens, and states that an FDA-approved test to detect ALK rearrangements for selecting patients for treatment with ensartinib is not yet available.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ALK", "gene2": null, "locus": null, "rearrangement_type": null } ], "feature_id": 1005, "feature_type": "rearrangement" } ], "last_updated": "2025-02-06", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Xcovery Holdings, Inc. Ensacove (ensartinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218171s000lbl.pdf. Revised December 2024. Accessed February 6, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 295, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/218171s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ensartinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ALK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1006, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to encorafenib in combination with cetuximab and mFOLFOX6 for the treatment of patients with metastatic colorectal cancer (mCRC) with a BRAF p.V600E variant, as detected by an FDA-approved test. mFOLFOX6 consists of oxaliplatin, folinic acid, and fluorouracil.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.1799T>A", "chromosome": "7", "end_position": "140453136", "exon": "15", "feature_type": "somatic_variant", "gene": "BRAF", "protein_change": "p.V600E", "reference_allele": "A", "rsid": "rs113488022", "start_position": "140453136", "variant_annotation": "Missense" } ], "feature_id": 1006, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-13", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Array BioPharma Inc. Braftovi (encorafenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/210496s017lbl.pdf. Revised December 2024. Accessed February 6, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 296, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2024/210496s017lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Cetuximab + Encorafenib + Fluorouracil + Oxaliplatin", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition + B-RAF inhibition + Platinum-based chemotherapy + Thymidylate synthase inhibition", "therapy_type": "Combination therapy", "validated": true }, { "assertion_id": 1007, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) has granted approval to panitumumab in combination with sotorasib for the treatment of adult patients with KRAS p.G12C-mutated metastatic colorectal cancer (mCRC), as determined by an FDA-approved test, who have received prior treatment with fluoropyrimidine-, oxaliplatin-, and irinotecan-based chemotherapy.", "disease": "Colorectal Adenocarcinoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.34G>T", "chromosome": "12", "end_position": "25398285", "exon": "2", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": "p.G12C", "reference_allele": "C", "rsid": "rs121913530", "start_position": "25398285", "variant_annotation": "Missense" } ], "feature_id": 1007, "feature_type": "somatic_variant" } ], "last_updated": "2025-02-06", "oncotree_code": "COADREAD", "oncotree_term": "Colorectal Adenocarcinoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Amgen Inc. Vectibix (panitumumab) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/125147s213lbl.pdf. Revised January 2025. Accessed February 6, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 297, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/125147s213lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Panitumumab + Sotorasib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition + RAS inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1008, "context": "Metastatic", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to taletrectinib for the treatment of adult patients with locally advanced or metastatic ROS1-positive non-small cell lung cancer. The package insert instructs to select patients based on the presence of ROS1 rearrangements in tumor specimen(s).", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "feature_type": "rearrangement", "gene1": "ROS1", "gene2": null, "locus": null, "rearrangement_type": "Fusion" } ], "feature_id": 1008, "feature_type": "rearrangement" } ], "last_updated": "2024-06-12", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Nuvation Bio Inc. Ibtrozi (taletrectinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/219713s000lbl.pdf. Revised June 2025. Accessed June 12, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 298, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/219713s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Taletrectinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "ROS1 inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1009, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to avutometinib in combination with defactinib (Avmapki Fakzynja co-pack) for the treatment of adult patients with KRAS-mutated recurrent low-grade serous ovarian cancer (LGSOC) who have received prior systemic therapy. The package insert notes that this indication is approved under accelerated approval based on tumor response rate and duration of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in a confirmatory trial. This approval is based on RAMP-201 (NCT04625270), an open-label, multicenter study that included 57 adult patients with measurable KRAS-mutated recurrent LGSOC. The KRAS mutations identified by local testing were G12V (53%), G12D (35%), Q61H (3.5%), G12C (1.8%), G12R (1.8%), A146V (1.8%), and mutations not otherwise specified at G12x (1.8%) and on codon 12/13 (1.8%). 44% of patients responded (3.5% with complete response, 40% with partial response), and the package insert notes that the tumor KRAS mutations observed in the 25 responders were A146V, G12D, G12R, G12V, and Q61H.", "disease": "Low-Grade Serous Ovarian Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.34G>T", "chromosome": "12", "end_position": "25398285", "exon": "2", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": "p.G12C", "reference_allele": "C", "rsid": "rs121913530", "start_position": "25398285", "variant_annotation": "Missense" } ], "feature_id": 1009, "feature_type": "somatic_variant" } ], "last_updated": "2024-06-12", "oncotree_code": "LGSOC", "oncotree_term": "Low-Grade Serous Ovarian Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Verastem Inc. Avmapki Fakzynja co-pack (avutometinib potassium; defactinib hydrochloride) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/219616s000lbl.pdf. Revised May 2025. Accessed June 12, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 299, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/219616s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Avutometinib + Defactinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition + FAK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1010, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to avutometinib in combination with defactinib (Avmapki Fakzynja co-pack) for the treatment of adult patients with KRAS-mutated recurrent low-grade serous ovarian cancer (LGSOC) who have received prior systemic therapy. The package insert notes that this indication is approved under accelerated approval based on tumor response rate and duration of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in a confirmatory trial. This approval is based on RAMP-201 (NCT04625270), an open-label, multicenter study that included 57 adult patients with measurable KRAS-mutated recurrent LGSOC. The KRAS mutations identified by local testing were G12V (53%), G12D (35%), Q61H (3.5%), G12C (1.8%), G12R (1.8%), A146V (1.8%), and mutations not otherwise specified at G12x (1.8%) and on codon 12/13 (1.8%). 44% of patients responded (3.5% with complete response, 40% with partial response), and the package insert notes that the tumor KRAS mutations observed in the 25 responders were A146V, G12D, G12R, G12V, and Q61H.", "disease": "Low-Grade Serous Ovarian Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "A", "cdna_change": "c.35G>T", "chromosome": "12", "end_position": "25398284", "exon": "2", "feature_type": "somatic_variant", "gene": "KRAS", "protein_change": "p.G12V", "reference_allele": "C", "rsid": "rs121913529", "start_position": "25398284", "variant_annotation": "Missense" } ], "feature_id": 1010, "feature_type": "somatic_variant" } ], "last_updated": "2024-06-12", "oncotree_code": "LGSOC", "oncotree_term": "Low-Grade Serous Ovarian Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Verastem Inc. Avmapki Fakzynja co-pack (avutometinib potassium; defactinib hydrochloride) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/219616s000lbl.pdf. Revised May 2025. Accessed June 12, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 299, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/219616s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Avutometinib + Defactinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "MEK inhibition + FAK inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1011, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to datopotamab deruxtecan-dlnk for the treatment of adult patients with locally advanced or metastatic epidermal growth factor (EGFR)-mutated non-small cell lung cancer (NSCLC) who have received prior EGFR-directed therapy and platinum-based chemotherapy. This indication is approved under accelerated approval based on objective response rate and duration of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in the confirmatory trial. This approval is based on two clinical studies: TROPION-Lung05 and TROPION-Lung01, where efficacy was assessed in 114 patients with EGFR-mutated NSCLC. Fifty-three percent (53%) of patients had exon 19 deletions, 34% had exon 21 L858R mutations, 28% had T790M mutations, 2.6% had exon 20 insertion mutations, and 14% had other EGFR mutations.", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": null, "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": null } ], "feature_id": 1011, "feature_type": "somatic_variant" } ], "last_updated": "2025-09-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Daiichi Sankyo, Inc. Datroway (datopotamab deruxtecan-dlnk) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/761464s000lbl.pdf. Revised June 2025. Accessed September 2, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 300, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/761464s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Datopotamab deruxtecan", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Topoisomerase inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1012, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to sunvozertinib for the treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with epidermal growth factor receptor (EGFR) exon 20 insertion mutations, as detected by an FDA-approved test, whose disease has progressed on or after platinum-based chemotherapy. This indication is approved under accelerated approval based on overall response rate and duration of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in confirmatory trial(s).", "disease": "Non-Small Cell Lung Cancer", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": null, "cdna_change": null, "chromosome": "7", "end_position": null, "exon": "20", "feature_type": "somatic_variant", "gene": "EGFR", "protein_change": null, "reference_allele": null, "rsid": null, "start_position": null, "variant_annotation": "Insertion" } ], "feature_id": 1012, "feature_type": "somatic_variant" } ], "last_updated": "2025-09-02", "oncotree_code": "NSCLC", "oncotree_term": "Non-Small Cell Lung Cancer", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Dizal (Jiangsu) Pharmaceutical Co., Ltd. Zegfrovy (sunvozertinib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/219839s000lbl.pdf. Revised July 2025. Accessed September 3, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 301, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/219839s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Sunvozertinib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "EGFR inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1013, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted accelerated approval to dordaviprone adult and pediatric patients 1 year of age and older with diffuse midline glioma harboring an H3 K27M mutation with progressive disease following prior therapy. This indication is approved under accelerated approval based on response rate and duration of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in a confirmatory trial. H3 K27M The underlying trials, including ONC018 (NCT03134131), assessed H3 K27M status through either IHC or sequencing for patient eligibility. The H3 K27M nomenclature refers to the H3-3A:c.83A>T p.K28M (K27M) variant.", "disease": "Diffuse Glioma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "T", "cdna_change": "c.83A>T", "chromosome": "1", "end_position": "226252135", "exon": "2", "feature_type": "somatic_variant", "gene": "H3-3A", "protein_change": "p.K28M", "reference_allele": "A", "rsid": "rs1057519903", "start_position": "226252135", "variant_annotation": "Missense" } ], "feature_id": 1013, "feature_type": "somatic_variant" } ], "last_updated": "2025-10-02", "oncotree_code": "DIFG", "oncotree_term": "Diffuse Glioma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Chimerix, Inc. Modeyso (dordaviprone) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/219876s000lbl.pdf. Revised August 2025. Accessed October 2, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 302, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/219876s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Dordaviprone", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Protease activation", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1014, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to ziftomenib for the treatment of adult patients with relapsed or refractory acute myeloid leukemia (AML) with a susceptible nucleophosmin 1 (NPM1) mutation who have no satisfactory alternative treatment options. This approval is based on NCT04067336, an open-label, single-arm, multicenter clinical trial of 112 patients where eligibility criteria included NPM1 mutations, including Type A (c.860_863dupTCTG), B (c.863_864insCATG), and D (c.863_864insCCTG) mutations and other NPM1 mutations likely to result in cytoplasmic localization of the NPM1 protein.", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "TCTG", "cdna_change": "c.860_863dup", "chromosome": "5", "end_position": "171410543", "exon": "11", "feature_type": "somatic_variant", "gene": "NPM1", "protein_change": "p.W288Cfs*12", "reference_allele": "-", "rsid": "rs587776806", "start_position": "171410544", "variant_annotation": "Frameshift" } ], "feature_id": 1014, "feature_type": "somatic_variant" } ], "last_updated": "2025-12-23", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Kura Oncology, Inc. Komzifti (ziftomenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/220305s000lbl.pdf. Revised November 2025. Accessed December 23, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 303, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/220305s000lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Ziftomenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Menin inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1015, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to revumenib for the treatment of adult and pediatric patients 1 year and older with relapsed or refractory acute myeloid leukemia and a susceptible .nucleophosmin 1 (NPM1) variant. The approval defines susceptible NPM1 mutations as those that result in a loss of the nucleolar localization signal and the insertion of a new nuclear export signal leading to the accumulation of mutant NPM1 in the cytoplasm of AML cells; the most common of such NPM1 variants in patients with AML being Types A (c.860_863dupTCTG), B (c.863_864insCATG), and D (c.863_864insCCTG).", "disease": "Acute Myeloid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "TCTG", "cdna_change": "c.860_863dup", "chromosome": "5", "end_position": "171410543", "exon": "11", "feature_type": "somatic_variant", "gene": "NPM1", "protein_change": "p.W288Cfs*12", "reference_allele": "-", "rsid": "rs587776806", "start_position": "171410544", "variant_annotation": "Frameshift" } ], "feature_id": 1015, "feature_type": "somatic_variant" } ], "last_updated": "2025-12-26", "oncotree_code": "AML", "oncotree_term": "Acute Myeloid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Syndax Pharmaceuticals, Inc. Revuforj (revumenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/218944s003lbl.pdf. Revised October 2025. Accessed December 26, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 304, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/218944s003lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Revumenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Menin inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1016, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to revumenib for the treatment of adult and pediatric patients 1 year and older with relapsed or refractory acute myeloid leukemia and a susceptible .nucleophosmin 1 (NPM1) variant. The approval defines susceptible NPM1 mutations as those that result in a loss of the nucleolar localization signal and the insertion of a new nuclear export signal leading to the accumulation of mutant NPM1 in the cytoplasm of AML cells; the most common of such NPM1 variants in patients with AML being Types A (c.860_863dupTCTG), B (c.863_864insCATG), and D (c.863_864insCCTG).", "disease": "Acute Lymphoid Leukemia", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "TCTG", "cdna_change": "c.860_863dup", "chromosome": "5", "end_position": "171410543", "exon": "11", "feature_type": "somatic_variant", "gene": "NPM1", "protein_change": "p.W288Cfs*12", "reference_allele": "-", "rsid": "rs587776806", "start_position": "171410544", "variant_annotation": "Frameshift" } ], "feature_id": 1016, "feature_type": "somatic_variant" } ], "last_updated": "2025-12-26", "oncotree_code": "ALL", "oncotree_term": "Acute Lymphoid Leukemia", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Syndax Pharmaceuticals, Inc. Revuforj (revumenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/218944s003lbl.pdf. Revised October 2025. Accessed December 26, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 304, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/218944s003lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Revumenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Menin inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1017, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to revumenib for the treatment of adult and pediatric patients 1 year and older with relapsed or refractory acute myeloid leukemia and a susceptible .nucleophosmin 1 (NPM1) variant. The approval defines susceptible NPM1 mutations as those that result in a loss of the nucleolar localization signal and the insertion of a new nuclear export signal leading to the accumulation of mutant NPM1 in the cytoplasm of AML cells; the most common of such NPM1 variants in patients with AML being Types A (c.860_863dupTCTG), B (c.863_864insCATG), and D (c.863_864insCCTG).", "disease": "Burkitt Lymphoma", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "TCTG", "cdna_change": "c.860_863dup", "chromosome": "5", "end_position": "171410543", "exon": "11", "feature_type": "somatic_variant", "gene": "NPM1", "protein_change": "p.W288Cfs*12", "reference_allele": "-", "rsid": "rs587776806", "start_position": "171410544", "variant_annotation": "Frameshift" } ], "feature_id": 1017, "feature_type": "somatic_variant" } ], "last_updated": "2025-12-26", "oncotree_code": "BL", "oncotree_term": "Burkitt Lymphoma", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Syndax Pharmaceuticals, Inc. Revuforj (revumenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/218944s003lbl.pdf. Revised October 2025. Accessed December 26, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 304, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/218944s003lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Revumenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Menin inhibition", "therapy_type": "Targeted therapy", "validated": true }, { "assertion_id": 1018, "context": "", "created_on": "05/07/26", "deprecated": false, "description": "The U.S. Food and Drug Administration (FDA) granted approval to revumenib for the treatment of adult and pediatric patients 1 year and older with relapsed or refractory acute myeloid leukemia and a susceptible .nucleophosmin 1 (NPM1) variant. The approval defines susceptible NPM1 mutations as those that result in a loss of the nucleolar localization signal and the insertion of a new nuclear export signal leading to the accumulation of mutant NPM1 in the cytoplasm of AML cells; the most common of such NPM1 variants in patients with AML being Types A (c.860_863dupTCTG), B (c.863_864insCATG), and D (c.863_864insCCTG).", "disease": "Acute Leukemias of Ambiguous Lineage", "favorable_prognosis": "", "features": [ { "attributes": [ { "alternate_allele": "TCTG", "cdna_change": "c.860_863dup", "chromosome": "5", "end_position": "171410543", "exon": "11", "feature_type": "somatic_variant", "gene": "NPM1", "protein_change": "p.W288Cfs*12", "reference_allele": "-", "rsid": "rs587776806", "start_position": "171410544", "variant_annotation": "Frameshift" } ], "feature_id": 1018, "feature_type": "somatic_variant" } ], "last_updated": "2025-12-26", "oncotree_code": "ALAL", "oncotree_term": "Acute Leukemias of Ambiguous Lineage", "predictive_implication": "FDA-Approved", "sources": [ { "citation": "Syndax Pharmaceuticals, Inc. Revuforj (revumenib) [package insert]. U.S. Food and Drug Administration website. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/218944s003lbl.pdf. Revised October 2025. Accessed December 26, 2025.", "doi": "", "nct": "", "pmid": "", "source_id": 304, "source_type": "FDA", "url": "https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/218944s003lbl.pdf" } ], "submitted_by": "breardon@broadinstitute.org", "therapy_name": "Revumenib", "therapy_resistance": "", "therapy_sensitivity": 1, "therapy_strategy": "Menin inhibition", "therapy_type": "Targeted therapy", "validated": true } ]